TkA01G456620 | RubberDandelionOmics

Gene overview

TkA01G456620

Reference: TK1151 Chr: Chr01 Coordinates: 114350218-114352029 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1171 bp · TkA01G456620|TK1151|cDNA

TTCTCGAACTTTTATAGCGGTCAAAACCCTCTAAACGATTAAAGTCTAAATAAACCGCATGAGTACATGACACATCCACCCTCTCCGTCTCACCTCACTTCTTCTCACTCTTTGCTCAGTCATGGCGGTTAGCAACAACATAATAGCCACTCTCAACTTTATAGCACTTCTCTGTTCCATTCCAATAATCACCGCCGGCATCTGGCTTGCGTCTAAACCGGACAACGAGTGCATCCGCTGGCTCAGGTGGCCGGTCATCA...

CDS

Download CDS FASTA

810 bp · TkA01G456620|TK1151|CDS

ATGGCGGTTAGCAACAACATAATAGCCACTCTCAACTTTATAGCACTTCTCTGTTCCATTCCAATAATCACCGCCGGCATCTGGCTTGCGTCTAAACCGGACAACGAGTGCATCCGCTGGCTCAGGTGGCCGGTCATCACTATCGGTGTTCTCTTCCTCTTCGTTGCCCTAACAGGCTTCATAGGTGCCTACTGGAACAAACAAGGCCTCTTAGCCTTCTACCTCTTCTGTAACGCTGCTCTCATCATCACCGGTCTCAT...

Protein

Download Protein FASTA

269 aa · TkA01G456620|TK1151|PROTEIN

MAVSNNIIATLNFIALLCSIPIITAGIWLASKPDNECIRWLRWPVITIGVLFLFVALTGFIGAYWNKQGLLAFYLFCNAALIITGLILLILAFVVTRPSGAYSVPGREYKEYRLMGYSEWLRDHITDSDNWGNIRACLASSSICTKMAQDSYTAAQFFASNISPLQSGCCKPPTACGYQYVNPVMWVNPTNPTGDMDCPIWNNDPNQLCYNCDSCKAGLLGNLRKEWRKANTILIIAIVALISLYVIACSAYRNAQTEEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G456620`
TK1151 ID	TkA01G456620
OH-1004 ID	LXL04_002443
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G456620

Location Chr01:114350218-114352029 (-)

Description Similar to TET2: Tetraspanin-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19580`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release
`At5g46700`	Involved in the basipetal transport of auxin (IAA) that modulates growth and organs organization, as well as cell differentiation.	Tornado1 and tornado2 are required for the specification of radial and circumferential pattern in the Arabidopsis root.2000 · DOI: 10.1242/dev.127.15.3385 The ekeko mutant demonstrates a role for tetraspanin-like protein in plant development.2003 · DOI: 10.1016/j.bbrc.2003.09.122 The TORNADO1 and TORNADO2 genes function in several patterning processes during early leaf development in Arabidopsis thaliana.2006 · DOI: 10.1105/tpc.105.040568 Mutations in the TORNADO2 gene affect cellular decisions in the peripheral zone of the shoot apical meristem of Arabidopsis thaliana.2007 · DOI: 10.1007/s11103-006-9105-z Arabidopsis WIH1 and WIH2 genes act in the transition from somatic to reproductive cell fate.2011 · DOI: 10.1016/j.cub.2011.05.015
`At5g60220`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release
`At2g23810`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release
`At3g45600`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002443 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0009554 megasporogenesis Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0009956 radial pattern formation Biological Process

GO:0010015 root morphogenesis Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0090110 COPII-coated vesicle cargo loading Biological Process

GO:0099039 sphingolipid translocation Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT2G19580

ath:AT2G23810

ath:AT3G45600

ath:AT4G28050

ath:AT5G46700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.803

Rank 1 · TkA01G456620 · TK1151

Cytoplasm0.111

Rank 2 · TkA01G456620 · TK1151

Lysosome / Vacuole0.086

Rank 3 · TkA01G456620 · TK1151

Endoplasmic reticulum0.063

Rank 4 · TkA01G456620 · TK1151

Nucleus0.038

Rank 5 · TkA01G456620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00335Tetraspanin6-249 aa

PF22954DUF70276-95 aa

PF20990DUF2207_C10-71 aa

PF13858DUF419911-27 aa

PF01757Acyl_transf_313-93 aa

PF20088DUF648033-58 aa

PF02544Steroid_dh44-99 aa

PF20990DUF2207_C47-123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G456620	`PF00335`	Tetraspanin	6	249	1.3e-32	114.0
TkA01G456620	`PF22954`	DUF7027	6	95	0.85	10.3
TkA01G456620	`PF20990`	DUF2207_C	10	71	0.00018	22.0
TkA01G456620	`PF13858`	DUF4199	11	27	1.5	9.8
TkA01G456620	`PF01757`	Acyl_transf_3	13	93	0.0022	17.8
TkA01G456620	`PF20088`	DUF6480	33	58	0.34	11.5
TkA01G456620	`PF02544`	Steroid_dh	44	99	0.093	13.4
TkA01G456620	`PF20990`	DUF2207_C	47	123	0.00018	22.0
TkA01G456620	`PF13858`	DUF4199	47	92	1.5	9.8
TkA01G456620	`PF13150`	TraL_transposon	69	79	0.13	12.7
TkA01G456620	`PF20088`	DUF6480	82	95	0.34	11.5
TkA01G456620	`PF13150`	TraL_transposon	218	253	0.13	12.7
TkA01G456620	`PF01757`	Acyl_transf_3	219	255	0.0022	17.8
TkA01G456620	`PF20088`	DUF6480	222	249	0.34	11.5
TkA01G456620	`PF13858`	DUF4199	232	269	1.5	9.8
TkA01G456620	`PF20990`	DUF2207_C	233	264	0.00018	22.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUN5`	Arabidopsis thaliana	sp\|Q9ZUN5\|TET2_ARATH Tetraspanin-2	66.200%	Swiss-Prot	High
`Q9FIQ5`	Arabidopsis thaliana	sp\|Q9FIQ5\|TRN2_ARATH Protein TORNADO 2	46.800%	Swiss-Prot	Medium
`Q9LSS4`	Arabidopsis thaliana	sp\|Q9LSS4\|TET4_ARATH Tetraspanin-4	42.400%	Swiss-Prot	Medium
`Q8S8Q6`	Arabidopsis thaliana	sp\|Q8S8Q6\|TET8_ARATH Tetraspanin-8	40.300%	Swiss-Prot	Medium
`Q9M1E7`	Arabidopsis thaliana	sp\|Q9M1E7\|TET3_ARATH Tetraspanin-3	41.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card