TkA01G456300 | RubberDandelionOmics

Gene overview

TkA01G456300

Reference: TK1151 Chr: Chr01 Coordinates: 114243973-114246026 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1120 bp · TkA01G456300|TK1151|cDNA

ATAATATGTATTTTGTTTCTTTATTTTAATTTACTTACTTTTGGTACATTCTGGTTCACACAAATCCCCTCACTTGTTCATCAAAATTTTGTAGAGTCCTCATCGAAGTCGGGTCTCTTCCCAAAATCCCCAAAACTATAAACTTCCCTCTCGTATAATCTTCCCACTCCCATACAAACACTCCAAATAATTGTATAAATTCCCTTGTAATCAATCGGTTCTATCTTTATATAGATTTTGAATTCAAATTCTGTTGTGTG...

CDS

Download CDS FASTA

669 bp · TkA01G456300|TK1151|CDS

ATGGCAGCTTTTGTTCGGTTGCTATCGTTCCATTCGTCCTCGTTATCGACGTCACTGAATTCTATTCACCAAAACCAATCACTATACAAAAACAACAGCAAGAGGGAAGTATCAGTTGCTGCAGATTCTTGTCTATCTTCTGATTTTATTCTTAATTCTCGATTTGCAATCAACCCCAGAAAGCAATCGTCGCAATTCAAGATACATGCAACAATTACGGAAACTGACCAGCCAAAATGGTGGGAGAAAAGTGGAGGACC...

Protein

Download Protein FASTA

222 aa · TkA01G456300|TK1151|PROTEIN

MAAFVRLLSFHSSSLSTSLNSIHQNQSLYKNNSKREVSVAADSCLSSDFILNSRFAINPRKQSSQFKIHATITETDQPKWWEKSGGPNMIDIHSTEEFLNALSEAGDKLVIVEFYGTWCASCRALFPKLCKTAQEHPEITFLKVNFDENKPMCKNLNVKVLPYFHFYRGADGQLESFSCSLAKFQKIKDAIRTHNTDRCSIGPIKGVGDVNLETVPTNKPAA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G456300`
TK1151 ID	TkA01G456300
OH-1004 ID	LXL04_002439
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G456300

Location Chr01:114243973-114246026 (+)

Description Similar to Os05g0200100: Thioredoxin-like 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26160`	Thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`At4g29670`	Thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`At1g08570`	Thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0200100`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`Os03g0326500`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002439 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010109 regulation of photosynthesis Biological Process

GO:0045454 cell redox homeostasis Biological Process

GO:0051776 detection of redox state Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0016671 oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor Molecular Function

KEGG gene cross-reference

ath:AT1G08570

ath:AT4G26160

ath:AT4G29670

dosa:Os03g0326500

dosa:Os05g0200100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.981

Rank 1 · TkA01G456300 · TK1151

Mitochondrion0.025

Rank 2 · TkA01G456300 · TK1151

Nucleus0.024

Rank 3 · TkA01G456300 · TK1151

Cytoplasm0.022

Rank 4 · TkA01G456300 · TK1151

Peroxisome0.014

Rank 5 · TkA01G456300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13905Thioredoxin_824-45 aa

PF08534Redoxin61-100 aa

PF02114Phosducin89-170 aa

PF14595Thioredoxin_992-154 aa

PF00085Thioredoxin93-178 aa

PF13098Thioredoxin_2101-173 aa

PF00578AhpC-TSA102-157 aa

PF08534Redoxin102-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G456300	`PF13905`	Thioredoxin_8	24	45	2.1e-05	25.6
TkA01G456300	`PF08534`	Redoxin	61	100	0.056	14.0
TkA01G456300	`PF02114`	Phosducin	89	170	0.025	14.3
TkA01G456300	`PF14595`	Thioredoxin_9	92	154	0.035	14.7
TkA01G456300	`PF00085`	Thioredoxin	93	178	5.7e-19	68.7
TkA01G456300	`PF13098`	Thioredoxin_2	101	173	0.079	14.0
TkA01G456300	`PF00578`	AhpC-TSA	102	157	0.015	16.0
TkA01G456300	`PF08534`	Redoxin	102	151	0.056	14.0
TkA01G456300	`PF13905`	Thioredoxin_8	107	171	2.1e-05	25.6
TkA01G456300	`PF10158`	LOH1CR12	128	194	0.013	16.3
TkA01G456300	`PF04756`	OST3_OST6	131	174	0.2	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LEK4`	Arabidopsis thaliana	sp\|Q8LEK4\|TRL21_ARATH Thioredoxin-like 2-1, chloroplastic	67.900%	Swiss-Prot	High
`Q8LCT3`	Arabidopsis thaliana	sp\|Q8LCT3\|TRL22_ARATH Thioredoxin-like 2-2, chloroplastic	75.800%	Swiss-Prot	Medium
`O64654`	Arabidopsis thaliana	sp\|O64654\|TRL11_ARATH Thioredoxin-like 1-1, chloroplastic	44.000%	Swiss-Prot	Medium
`Q5TKD8`	Oryza sativa subsp. japonica	sp\|Q5TKD8\|TRL2_ORYSJ Thioredoxin-like 2, chloroplastic	75.900%	Swiss-Prot	High
`Q10M18`	Oryza sativa subsp. japonica	sp\|Q10M18\|TRL12_ORYSJ Thioredoxin-like 1-2, chloroplastic	48.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card