TkA01G451960 | RubberDandelionOmics

Gene overview

TkA01G451960

Reference: TK1151 Chr: Chr01 Coordinates: 113124017-113130029 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4199 bp · TkA01G451960|TK1151|cDNA

CAATTATACTAACAGTGGTTATTTTGTAATATTATCTTTCCATTCGTTATTATTTCAGTGATTAACACTCGATACATTACATAAATGATGATTACGAGAATGCTTAATTTGACTTGGTTAATAGATGTATAAGTTATTCGAGTTTAATGCAAATAAAGACATCTACTTCATCACAATTATAAACTATGCCCCACACCTTCGACACGTCTTTCATCAAGAGAGGTGTTATTTGCTTTCATACATCTCTCGTCTTCTACCGG...

CDS

Download CDS FASTA

3450 bp · TkA01G451960|TK1151|CDS

ATGTCGGAGAACAGAGATGGGTTGGATTACCTCCGAATTCCATTTGAGAAGATCAAGTTTGGTAAGAAACTCGAAGGTCACGGCTATGGAAGTGTGTTCGAGGGAGAATTTGGTGATCGGCGAGTTGCATTAAAGCAATTGAACATAACGAACCTTGGCAATATTAAACCCAAGCTTCTAGCTGAGATATTAACGATTTCTCGGTTCCGGCTACACCCGAATCTCGTGGCTCTTCTCGGTTTCTGTGACGAAAGGAGCAA...

Protein

Download Protein FASTA

1149 aa · TkA01G451960|TK1151|PROTEIN

MSENRDGLDYLRIPFEKIKFGKKLEGHGYGSVFEGEFGDRRVALKQLNITNLGNIKPKLLAEILTISRFRLHPNLVALLGFCDERSNEIILVYEYVASGNLAEKMRKRLTTIQRFEICLGAARGLDHLHTGVDSSTIVHGHVKLSKILLNSDSNSSKFEPKLSSFGLSKIVPGKTQTDPKDEVNEKPTKESDVYAFGVLLLEVLCGVSELVDTDDYQERHVSELVPKRLEQDKLRKIVHFDIRREIKTEALETYAKIACQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G451960`
TK1151 ID	TkA01G451960
OH-1004 ID	LXL04_002364
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	83.600
Protein coverage (%)	TK1151 24.108 / OH-1004 78.830 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G451960

Location Chr01:113124017-113130029 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g24010`	Probable receptor-like protein kinase At5g24010.	No verified direct reference in this release
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At5g38990`	Probable receptor-like protein kinase At5g38990.	No verified direct reference in this release
`At5g39000`	Putative receptor-like protein kinase At5g39000.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002364 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.560

Rank 1 · TkA01G451960 · TK1151

Cytoplasm0.319

Rank 2 · TkA01G451960 · TK1151

Nucleus0.192

Rank 3 · TkA01G451960 · TK1151

Endoplasmic reticulum0.044

Rank 4 · TkA01G451960 · TK1151

Golgi apparatus0.037

Rank 5 · TkA01G451960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr18-279 aa

PF00069Pkinase29-277 aa

PF07714PK_Tyr_Ser-Thr607-865 aa

PF00069Pkinase617-863 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G451960	`PF07714`	PK_Tyr_Ser-Thr	18	279	1.9e-55	188.7
TkA01G451960	`PF00069`	Pkinase	29	277	4.9e-49	167.8
TkA01G451960	`PF07714`	PK_Tyr_Ser-Thr	607	865	1.9e-55	188.7
TkA01G451960	`PF00069`	Pkinase	617	863	4.9e-49	167.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX66`	Arabidopsis thaliana	sp\|Q9LX66\|HERK_ARATH Receptor-like protein kinase HERK 1	36.900%	Swiss-Prot	Low
`Q9FLW0`	Arabidopsis thaliana	sp\|Q9FLW0\|Y5241_ARATH Probable receptor-like protein kinase At5g24010	36.600%	Swiss-Prot	Low
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	35.700%	Swiss-Prot	Low
`Q9FID9`	Arabidopsis thaliana	sp\|Q9FID9\|Y5389_ARATH Probable receptor-like protein kinase At5g38990	37.800%	Swiss-Prot	Low
`Q9FID8`	Arabidopsis thaliana	sp\|Q9FID8\|Y5900_ARATH Putative receptor-like protein kinase At5g39000	37.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card