TkA01G443850 | RubberDandelionOmics

Gene overview

TkA01G443850

Reference: TK1151 Chr: Chr01 Coordinates: 111086015-111088267 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2172 bp · TkA01G443850|TK1151|cDNA

TGCAGTCAGTCGGTGGTCGTTTTTCCCGTGAACAAAGATACCCTCTCTCCATTAATCTACTATTTATTCTACTTATTGAAAATATCACTCATACATGCATCGTCTCCCAACCATACCCCATCCCATCCATGAATTTAAAGAAAGGTCGGAGGCACTGCATGTGATCTTTGTCCTTTTTACCACCACTCTATAAAATATGCAAACATGGCTCTTGGTTTCATAATTTTGTACTCTTGTTTATGTCATTACTGTTATATAAA...

CDS

Download CDS FASTA

1635 bp · TkA01G443850|TK1151|CDS

ATGTCTTTCTTCCACTTCCTGTTCCTAATACTGTTCCTCACAACACATCAGACTCTCTCAGTCTCAGATCGATCTTCTTTAGATTCGGTCTGTAAGTCGACGCCATACCCTGATGTCTGCTTCGAATCATCGAAACTATCGATCTCCATTAACATCAACGTTAATGTCATCCTCCAGTCTCTTCAATCCGCCATAACCGAAGGTGTTAAGCTATTACCTTTATTGTCAAACATCGATGGCGGTAAAATCATCGAGAAACA...

Protein

Download Protein FASTA

544 aa · TkA01G443850|TK1151|PROTEIN

MSFFHFLFLILFLTTHQTLSVSDRSSLDSVCKSTPYPDVCFESSKLSISININVNVILQSLQSAITEGVKLLPLLSNIDGGKIIEKQKGTIQDCNELHQITLSSLKKSLSRLSTTSSSSLADARAFLSAAVTNKNTCLEGLESASGPLKPYLVDSITTAYKHVSNSLSLLSSSGSNAKESKNHVHVHHKGVGFPKWMHRKDRKIFRNDYDDADDDDDYDYDYNTITVANDGSGNFTTITDAINFSPNNSVDRVLIYIKQG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G443850`
TK1151 ID	TkA01G443850
OH-1004 ID	LXL04_002271
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G443850

Location Chr01:111086015-111088267 (+)

Description Similar to PME12: Probable pectinesterase/pectinesterase inhibitor 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26440`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At4g02330`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At3g43270`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At4g02320`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At1g02810`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002271 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009620 response to fungus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0042545 cell wall modification Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:1902074 response to salt Biological Process

GO:0005576 extracellular region Cellular Component

GO:0030599 pectinesterase activity Molecular Function

KEGG gene cross-reference

ath:AT2G26440

ath:AT3G43270

ath:AT4G02320

ath:AT4G02330

ath:AT4G33220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.308

Rank 1 · TkA01G443850 · TK1151

Lysosome / Vacuole0.213

Rank 2 · TkA01G443850 · TK1151

Cell membrane0.144

Rank 3 · TkA01G443850 · TK1151

Endoplasmic reticulum0.140

Rank 4 · TkA01G443850 · TK1151

Cytoplasm0.111

Rank 5 · TkA01G443850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043PMEI26-169 aa

PF01095Pectinesterase225-529 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G443850	`PF04043`	PMEI	26	169	2e-21	77.4
TkA01G443850	`PF01095`	Pectinesterase	225	529	4.3e-130	433.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48711`	Arabidopsis thaliana	sp\|O48711\|PME12_ARATH Probable pectinesterase/pectinesterase inhibitor 12	59.900%	Swiss-Prot	High
`Q8RXK7`	Arabidopsis thaliana	sp\|Q8RXK7\|PME41_ARATH Probable pectinesterase/pectinesterase inhibitor 41	41.100%	Swiss-Prot	Medium
`Q9LXK7`	Arabidopsis thaliana	sp\|Q9LXK7\|PME32_ARATH Probable pectinesterase/pectinesterase inhibitor 32	45.300%	Swiss-Prot	Medium
`O81301`	Arabidopsis thaliana	sp\|O81301\|PME40_ARATH Probable pectinesterase/pectinesterase inhibitor 40	43.800%	Swiss-Prot	Medium
`Q9SRX4`	Arabidopsis thaliana	sp\|Q9SRX4\|PME7_ARATH Probable pectinesterase/pectinesterase inhibitor 7	39.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card