TkA01G440800 | RubberDandelionOmics

Gene overview

TkA01G440800

Reference: TK1151 Chr: Chr01 Coordinates: 110127654-110128721 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1035 bp · TkA01G440800|TK1151|cDNA

ATGAAGCCCATTCTACCTCCGCCGCCCACCGCATCTGCTAATCGTCCACGACGTCGTCCTGACCTAACCCTACCCTTGCCCCAACGTCAACCCCAAATCGCCGTCCCCCTCCCTCTCCCACCCACTTCAGCCCCTAGACAGCAACCCTTCAACATATCGGAACTCGACCGTATGAACAGAATCGGCAGCGGTAGCGGCGGAACCGTCTATAAAGTACTCCACCGCCCTACCGGCCGACCGTTCGCCCTCAAAGTAATCTA...

CDS

Download CDS FASTA

1035 bp · TkA01G440800|TK1151|CDS

ATGAAGCCCATTCTACCTCCGCCGCCCACCGCATCTGCTAATCGTCCACGACGTCGTCCTGACCTAACCCTACCCTTGCCCCAACGTCAACCCCAAATCGCCGTCCCCCTCCCTCTCCCACCCACTTCAGCCCCTAGACAGCAACCCTTCAACATATCGGAACTCGACCGTATGAACAGAATCGGCAGCGGTAGCGGCGGAACCGTCTATAAAGTACTCCACCGCCCTACCGGCCGACCGTTCGCCCTCAAAGTAATCTA...

Protein

Download Protein FASTA

344 aa · TkA01G440800|TK1151|PROTEIN

MKPILPPPPTASANRPRRRPDLTLPLPQRQPQIAVPLPLPPTSAPRQQPFNISELDRMNRIGSGSGGTVYKVLHRPTGRPFALKVIYGNHEDDVRRQICREIEILRDVDNLNIVKCHDMFDHGGEIQVLLEYMDGGSLEGTHISHEASLADLTRQVLSGIYYLHRRKIVHRDIKPSNLLINSKKQVKIADFGVSRILAQTMDPCNSSVGTIAYMSPERINTDLNHGKYDGFAGDIWSLGVSILEFYLGRFPFAVGRQGDW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G440800`
TK1151 ID	TkA01G440800
OH-1004 ID	LXL04_002232
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.400
Protein coverage (%)	TK1151 94.186 / OH-1004 92.798 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G440800

Location Chr01:110127654-110128721 (-)

Description Similar to MKK5: Mitogen-activated protein kinase kinase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g21220`	Mitogen-activated protein kinase kinase (MAPKK) which regulates abscisic acid (ABA) responses in a MAPKKK20-MKK5-MPK6 cascade involved in root growth (e.g. root cell division and elongation) and stomatal response, probably via MAPK6 activation by protein phosphorylation.	Cell death mediated by MAPK is associated with hydrogen peroxide production in Arabidopsis.2002 · DOI: 10.1074/jbc.m109495200 MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048298 Ethylene signaling is required for the acceleration of cell death induced by the activation of AtMEK5 in Arabidopsis.2008 · DOI: 10.1038/cr.2008.29 Regulation of floral organ abscission in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0805539105 A Pseudomonas syringae ADP-ribosyltransferase inhibits Arabidopsis mitogen-activated protein kinase kinases.2010 · DOI: 10.1105/tpc.110.075697 A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation.2012 · DOI: 10.1105/tpc.112.104695 Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana.2013 · DOI: 10.1074/jbc.m112.384453 MKK5 regulates high light-induced gene expression of Cu/Zn superoxide dismutase 1 and 2 in Arabidopsis.2013 · DOI: 10.1093/pcp/pct072 Identification of BZR1-interacting proteins as potential components of the brassinosteroid signaling pathway in Arabidopsis through tandem affinity purification.2013 · DOI: 10.1074/mcp.m113.029256 AIK1, A Mitogen-Activated Protein Kinase, Modulates Abscisic Acid Responses through the MKK5-MPK6 Kinase Cascade.2017 · DOI: 10.1104/pp.16.01386
`At1g51660`	Involved in the second phase of hydrogen peroxide generation during hypersensitive response-like cell death.	MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048298 Regulation of floral organ abscission in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0805539105 Arabidopsis MKK4 mediates osmotic-stress response via its regulation of MPK3 activity.2011 · DOI: 10.1016/j.bbrc.2011.07.064 A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation.2012 · DOI: 10.1105/tpc.112.104695 Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana.2013 · DOI: 10.1074/jbc.m112.384453
`At1g73500`	MKK9-MPK3/MPK6 module phosphorylates and activates EIN3, leading to the promotion of EIN3-mediated transcription in ethylene signaling.	Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling.2008 · DOI: 10.1038/nature06543 Activation of MAPK kinase 9 induces ethylene and camalexin biosynthesis and enhances sensitivity to salt stress in Arabidopsis.2008 · DOI: 10.1074/jbc.m801392200 An arabidopsis mitogen-activated protein kinase cascade, MKK9-MPK6, plays a role in leaf senescence.2009 · DOI: 10.1104/pp.108.133439
`At1g18350`	May function as a negative regulator of polar auxin transport.	Increased expression of MAP KINASE KINASE7 causes deficiency in polar auxin transport and leads to plant architectural abnormality in Arabidopsis.2006 · DOI: 10.1105/tpc.105.037846 Overexpression of Arabidopsis MAP kinase kinase 7 leads to activation of plant basal and systemic acquired resistance.2007 · DOI: 10.1111/j.1365-313x.2007.03294.x
`At3g06230`	Mitogen-activated protein kinase kinase 8.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002232 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000165 MAPK cascade Biological Process

GO:0002229 defense response to oomycetes Biological Process

GO:0007165 signal transduction Biological Process

GO:0009611 response to wounding Biological Process

GO:0009620 response to fungus Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009875 pollen-pistil interaction Biological Process

KEGG gene cross-reference

ath:AT1G18350

ath:AT1G51660

ath:AT1G73500

ath:AT3G06230

ath:AT3G21220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.575

Rank 1 · TkA01G440800 · TK1151

Cytoplasm0.549

Rank 2 · TkA01G440800 · TK1151

Cell membrane0.088

Rank 3 · TkA01G440800 · TK1151

Endoplasmic reticulum0.043

Rank 4 · TkA01G440800 · TK1151

Lysosome / Vacuole0.036

Rank 5 · TkA01G440800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13095FTA236-95 aa

PF00069Pkinase57-310 aa

PF14531Kinase-like57-90 aa

PF07714PK_Tyr_Ser-Thr58-306 aa

PF01636APH60-148 aa

PF03109ABC161-108 aa

PF17667Pkinase_fungal66-115 aa

PF01163RIO189-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G440800	`PF13095`	FTA2	36	95	0.0033	17.8
TkA01G440800	`PF00069`	Pkinase	57	310	3.5e-65	220.7
TkA01G440800	`PF14531`	Kinase-like	57	90	3.4e-06	27.2
TkA01G440800	`PF07714`	PK_Tyr_Ser-Thr	58	306	5.2e-36	125.0
TkA01G440800	`PF01636`	APH	60	148	0.0045	17.5
TkA01G440800	`PF03109`	ABC1	61	108	2.4e-06	27.6
TkA01G440800	`PF17667`	Pkinase_fungal	66	115	0.00095	18.7
TkA01G440800	`PF01163`	RIO1	89	192	0.19	12.1
TkA01G440800	`PF12330`	Haspin_kinase	117	197	0.019	14.8
TkA01G440800	`PF03109`	ABC1	129	198	2.4e-06	27.6
TkA01G440800	`PF14531`	Kinase-like	146	253	3.4e-06	27.2
TkA01G440800	`PF13095`	FTA2	153	181	0.0033	17.8
TkA01G440800	`PF17667`	Pkinase_fungal	154	221	0.00095	18.7
TkA01G440800	`PF01636`	APH	163	186	0.0045	17.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXG3`	Arabidopsis thaliana	sp\|Q8RXG3\|M2K5_ARATH Mitogen-activated protein kinase kinase 5	75.100%	Swiss-Prot	High
`O80397`	Arabidopsis thaliana	sp\|O80397\|M2K4_ARATH Mitogen-activated protein kinase kinase 4	67.800%	Swiss-Prot	High
`Q9FX43`	Arabidopsis thaliana	sp\|Q9FX43\|M2K9_ARATH Mitogen-activated protein kinase kinase 9	52.100%	Swiss-Prot	High
`Q9LPQ3`	Arabidopsis thaliana	sp\|Q9LPQ3\|M2K7_ARATH Mitogen-activated protein kinase kinase 7	50.000%	Swiss-Prot	High
`Q9M8J5`	Arabidopsis thaliana	sp\|Q9M8J5\|M2K8_ARATH Mitogen-activated protein kinase kinase 8	47.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card