TkA01G437820 | RubberDandelionOmics

Gene overview

TkA01G437820

Reference: TK1151 Chr: Chr01 Coordinates: 109404577-109408503 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1757 bp · TkA01G437820|TK1151|cDNA

CTTATAGCATATTTTTTGATCATGGGCTTTCGATCCGTTTAACCAACCCGCTTTGAATTTTGAAATCGGCCATTAATTCTGCGAAAAACCCTAACCTCCTAAAACATACTGAATAATCTTTAATTCAACTGAGTCAGGTAAACGTTTCTATTTTTTTTGCTGGATTACATAACTTTGCACTTACATTTCATTGAATTAAGCTCAATTAATCCATGCACAAGTCACATGGTTGCTTTTCGGCTTGTCCTCCATAAAAATCA...

CDS

Download CDS FASTA

1365 bp · TkA01G437820|TK1151|CDS

ATGGTTGCTTTTCGGCTTGTCCTCCATAAAAATCATGTTTCGGCAATGTTGGATGAAAGCAAATTTGATGTACATTTGAAGTTGTGGGCACTTCGAATCCCTAGAGAGTTCTGCAAGGTTGCAACTAAGTTGCTTAATGGACATATGCTTGATAGACCACGTATCAAGCCCATTACTGAAGACCCAACTAGTGAAAAAACCCGTTATGTGATATTATCTGAAAGGGTTCAAAATCCAGATCTGTCAGATCTTCCAACCCA...

Protein

Download Protein FASTA

454 aa · TkA01G437820|TK1151|PROTEIN

MVAFRLVLHKNHVSAMLDESKFDVHLKLWALRIPREFCKVATKLLNGHMLDRPRIKPITEDPTSEKTRYVILSERVQNPDLSDLPTQNLDELKKLCKIETVPYSLTLGYSYWGADHVLKQILPPGLEVPSSFETIGHIAHLNIPDELLPYKDIIAKVIYDKNHPRIQTVVNKVGSITNEFRVPKFEILAGKTEMTTEVKQYGAIFKLDYGLVYWNSRLEHEHIRLVNKFQKGDIICDMFAGIGPFAIPSAQKGCLVYAND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G437820`
TK1151 ID	TkA01G437820
OH-1004 ID	LXL04_002587
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G437820

Location Chr01:109404577-109408503 (-)

Description Similar to VIT_11s0016g04350: tRNA (guanine(37)-N1)-methyltransferase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56120`	Specifically methylates the N1 position of guanosine-37 in various cytoplasmic and mitochondrial tRNAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002587 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002939 tRNA N1-guanine methylation Biological Process

GO:0070901 mitochondrial tRNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0008175 tRNA methyltransferase activity Molecular Function

GO:0052906 tRNA (guanine(37)-N1)-methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G56120

pif:PITG_12867

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.490

Rank 1 · TkA01G437820 · TK1151

Nucleus0.439

Rank 2 · TkA01G437820 · TK1151

Mitochondrion0.183

Rank 3 · TkA01G437820 · TK1151

Cell membrane0.049

Rank 4 · TkA01G437820 · TK1151

Endoplasmic reticulum0.038

Rank 5 · TkA01G437820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25133TYW2_N_2117-191 aa

PF02475TRM5-TYW2_MTfase196-303 aa

PF05958tRNA_U5-meth_tr228-280 aa

PF06325PrmA229-288 aa

PF02086MethyltransfD12229-274 aa

PF09445Methyltransf_15234-294 aa

PF02005TRM255-295 aa

PF24698DUF7662345-364 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G437820	`PF25133`	TYW2_N_2	117	191	5.8e-22	78.3
TkA01G437820	`PF02475`	TRM5-TYW2_MTfase	196	303	1.4e-25	90.9
TkA01G437820	`PF05958`	tRNA_U5-meth_tr	228	280	0.17	11.5
TkA01G437820	`PF06325`	PrmA	229	288	0.05	13.8
TkA01G437820	`PF02086`	MethyltransfD12	229	274	0.079	13.4
TkA01G437820	`PF09445`	Methyltransf_15	234	294	0.037	14.3
TkA01G437820	`PF02005`	TRM	255	295	0.0012	18.9
TkA01G437820	`PF24698`	DUF7662	345	364	0.27	11.8
TkA01G437820	`PF02475`	TRM5-TYW2_MTfase	347	371	1.4e-25	90.9
TkA01G437820	`PF04532`	DUF587	365	389	0.18	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YU6`	Arabidopsis thaliana	sp\|Q93YU6\|TRM51_ARATH tRNA (guanine(37)-N(1))-methyltransferase 1	61.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card