TkA01G426200 | RubberDandelionOmics

Gene overview

TkA01G426200

Reference: TK1151 Chr: Chr01 Coordinates: 106411056-106412708 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1653 bp · TkA01G426200|TK1151|cDNA

ATGGAATCACTGTTTGGTGATCGGATTGCTGTTCCTCCAGATATAGGAGATTTTTCTAATGTTGGAAATGTTGAAGTTGAAGACACGAACAACAATACTGAATATGTGGATGCTTCTGATGCCACTGCCAGTGTTGATTCTCTTAAGACTGCTAAGAGGAAGAAGAAGAATATCATTAAGGAGAAATTGACGACTACGATGGAAATTAAAAAAATGAGAAGAGAAAGGCAAGCTGAACAAGTTGCAAAGAAGAACATGTT...

CDS

Download CDS FASTA

1653 bp · TkA01G426200|TK1151|CDS

ATGGAATCACTGTTTGGTGATCGGATTGCTGTTCCTCCAGATATAGGAGATTTTTCTAATGTTGGAAATGTTGAAGTTGAAGACACGAACAACAATACTGAATATGTGGATGCTTCTGATGCCACTGCCAGTGTTGATTCTCTTAAGACTGCTAAGAGGAAGAAGAAGAATATCATTAAGGAGAAATTGACGACTACGATGGAAATTAAAAAAATGAGAAGAGAAAGGCAAGCTGAACAAGTTGCAAAGAAGAACATGTT...

Protein

Download Protein FASTA

550 aa · TkA01G426200|TK1151|PROTEIN

MESLFGDRIAVPPDIGDFSNVGNVEVEDTNNNTEYVDASDATASVDSLKTAKRKKKNIIKEKLTTTMEIKKMRRERQAEQVAKKNMLRGKNLETIRHTNGDGSNPHLNANSNSNSDQIKQHSNEMEFENSDSEPNMSDLDGANSILIDAEMQAKIDKAVNDYEINASVETGNEQGMDNSKKNLNINDQKLQLGDNGDPSLFPGGPVWLGKANSNGMNQSIENTNCEDPRGLNRPSVFSSVGSKDDPISVSSLNPNVNHSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G426200`
TK1151 ID	TkA01G426200
OH-1004 ID	LXL04_022527
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	45.400
Protein coverage (%)	TK1151 93.091 / OH-1004 35.946 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G426200`
Location	Chr01:106411056-106412708 (+)
Description	Similar to VPS51: Vacuolar protein sorting-associated protein 51 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022527` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000727 double-strand break repair via break-induced replication Biological Process GO:0006270 DNA replication initiation Biological Process GO:0006271 DNA strand elongation involved in DNA replication Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006869 lipid transport Biological Process GO:0006914 autophagy Biological Process GO:0007030 Golgi organization Biological Process GO:0007034 vacuolar transport Biological Process GO:0007041 lysosomal transport Biological Process GO:0009555 pollen development Biological Process GO:0010182 sugar mediated signaling pathway Biological Process GO:0010305 leaf vascular tissue pattern formation Biological Process
KEGG gene cross-reference	ath:AT4G02030 ath:AT4G02060 dme:Dmel_CG15087 dosa:Os12g0560700 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.584

Rank 1 · TkA01G426200 · TK1151

Nucleus0.371

Rank 2 · TkA01G426200 · TK1151

Cell membrane0.076

Rank 3 · TkA01G426200 · TK1151

Mitochondrion0.045

Rank 4 · TkA01G426200 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA01G426200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14111DUF4283355-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G426200	`PF14111`	DUF4283	355	432	4.9e-14	52.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card