TkA01G421440 | RubberDandelionOmics

Gene overview

TkA01G421440

Reference: TK1151 Chr: Chr01 Coordinates: 105261326-105264801 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2495 bp · TkA01G421440|TK1151|cDNA

ACTCAACTAGTACTCCAATTTCACGGTAATAGTTACACCGCGCTGCACATGATAACCACCGTGCTTACCGCCTTCCTCCTTTCCGATCCTAATTGACGACATCAATTAGAAAAAAATTATCACATCGATTTTTACATTATAATCAACAATGGCCGGAGGAGGCTACAATAAGCAAAAGCTCAACAAATCCAAGAACCGAAAACCCCTGAAACCATCTCCATTTGTGGAGGCTGGTTTGTTATCCGATTGGTCTCCCGTTG...

CDS

Download CDS FASTA

2151 bp · TkA01G421440|TK1151|CDS

ATGGCCGGAGGAGGCTACAATAAGCAAAAGCTCAACAAATCCAAGAACCGAAAACCCCTGAAACCATCTCCATTTGTGGAGGCTGGTTTGTTATCCGATTGGTCTCCCGTTGTCGATTCTCCCTCTCCCAGAGGAAAGAGTAATAATGGCAACAATAGTGGAAATTATTCGAATGCGTCGAAGAACAAATCTGCAGCGAGATTTGCGAGCGGGAGTGGTTCTGGTGGTAAATCGAAAGCCTCGGGTTCCAATTCGAGAAA...

Protein

Download Protein FASTA

716 aa · TkA01G421440|TK1151|PROTEIN

MAGGGYNKQKLNKSKNRKPLKPSPFVEAGLLSDWSPVVDSPSPRGKSNNGNNSGNYSNASKNKSAARFASGSGSGGKSKASGSNSRNVEPQKPKMNAIGYIYPQIDPLLDESGDGSNKLDESDPLVIVDTKESKLVAFVDQTQVKEPEAVKYSYESVTETSLEVDDSFHRGLGFHEEEEEEEEEEEEEEEEEEEEEDPSVTEASPFIENKEGSISDSSSSEEIETDEEEEDDDDIADEEESLDSSESVDSSNSSDSDSDI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G421440`
TK1151 ID	TkA01G421440
OH-1004 ID	LXL04_002776
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G421440`
Location	Chr01:105261326-105264801 (-)
Description	Similar to GPATCH2: G patch domain-containing protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002776` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0016607 nuclear speck Cellular Component GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function GO:0001227 DNA-binding transcription repressor activity, RNA polymerase II-specific Molecular Function GO:0003676 nucleic acid binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	aag:5564857 ath:AT2G24830 dmo:Dmoj_GI17578 hsa:55105 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.719

Rank 1 · TkA01G421440 · TK1151

Cytoplasm0.318

Rank 2 · TkA01G421440 · TK1151

Cell membrane0.071

Rank 3 · TkA01G421440 · TK1151

Endoplasmic reticulum0.045

Rank 4 · TkA01G421440 · TK1151

Mitochondrion0.020

Rank 5 · TkA01G421440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12656G-patch_23-21 aa

PF15256SPATIAL168-231 aa

PF12656G-patch_2170-192 aa

PF12656G-patch_2387-403 aa

PF01424R3H412-469 aa

PF15256SPATIAL498-549 aa

PF01585G-patch593-636 aa

PF12656G-patch_2595-637 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G421440	`PF12656`	G-patch_2	3	21	1.4e-09	38.6
TkA01G421440	`PF15256`	SPATIAL	168	231	6.1	7.8
TkA01G421440	`PF12656`	G-patch_2	170	192	1.4e-09	38.6
TkA01G421440	`PF12656`	G-patch_2	387	403	1.4e-09	38.6
TkA01G421440	`PF01424`	R3H	412	469	4.1e-09	37.1
TkA01G421440	`PF15256`	SPATIAL	498	549	6.1	7.8
TkA01G421440	`PF01585`	G-patch	593	636	2e-29	101.9
TkA01G421440	`PF12656`	G-patch_2	595	637	1.4e-09	38.6
TkA01G421440	`PF01585`	G-patch	672	716	2e-29	101.9
TkA01G421440	`PF12656`	G-patch_2	674	716	1.4e-09	38.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card