RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G421030
Reference: TK1151 Chr: Chr01 Coordinates: 105162371-105170336 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5433 bp · TkA01G421030|TK1151|cDNA

CCAATATAAAAAACCTCAACTACTTCAGCACCTGGTGGCACAAAACCTCCGGTCAGTCGTCGTCATCTCTATGCGCCTTCAACCCCACCCTCCCACAAAAGCAGAAACACACATCCTCTTTCTCTCTATAATCTAATATACTTTGTACACTTTCTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAGAAACCTGATTGATTGCGAAACTTTAATATATTCTGTCTTAGTCTTTAAGTTTATCGTCAACGAAGAGTCAA...

CDS

Download CDS FASTA

4905 bp · TkA01G421030|TK1151|CDS

ATGGGGAACATTAGCGAGAACATTAATGTCACGGGAGGACTGGAAGCTATGTCGATCAGTAACCCAATTTTAAACGGGGGGAACGAAGAAGACGAGGGATCGGCTATGTCAGAAATCCAATTGCAGACAACCGGGAAGGATCCGAGGAGAATCGCGAGAGGGTACCAAATTGAGTTATGTGAAAAGGCTTTAATGGAGAACGTTATAGTGTATCTAGAAACAGGTTGTGGAAAGACCCACATTGCTGTTTTACTTATTTA...

Protein

Download Protein FASTA

1634 aa · TkA01G421030|TK1151|PROTEIN

MGNISENINVTGGLEAMSISNPILNGGNEEDEGSAMSEIQLQTTGKDPRRIARGYQIELCEKALMENVIVYLETGCGKTHIAVLLIYEINRQMKKSQKEICIFLAPTVALVEQQAKVIKDSIDVEVGIYCGSSKGLKGHHDWEKELEQHEVFVMTPQILLHNLSHCYIRMEHIALLIFDECHYAQVESNHPYAEIMKIFYKPGIPKLPRIFGMTASPIFGKGASISSLETLLHAKVYTVEAREELDKFVSSPKLRFYYYG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G421030
TK1151 IDTkA01G421030
OH-1004 IDLXL04_002782
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.600
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G421030
LocationChr01:105162371-105170336 (-)
DescriptionSimilar to DCL4: Dicer-like protein 4
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g20320 Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).
Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024
DICER-LIKE 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana.2005 · DOI: 10.1073/pnas.0506426102
A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis.2005 · DOI: 10.1101/gad.1352605
DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal.2005 · DOI: 10.1038/ng1675
DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7.2006 · DOI: 10.1016/j.cub.2006.03.035
An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral siRNAs.2006 · DOI: 10.1038/sj.emboj.7601217
Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs.2007 · DOI: 10.1105/tpc.106.047449
Transitivity in Arabidopsis can be primed, requires the redundant action of the antiviral Dicer-like 4 and Dicer-like 2, and is compromised by viral-encoded suppressor proteins.2007 · DOI: 10.1261/rna.541307
A novel class of bacteria-induced small RNAs in Arabidopsis.2007 · DOI: 10.1101/gad.1595107
Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1.2008 · DOI: 10.1073/pnas.0805760105
At3g03300 Ribonuclease (RNase) III involved in RNA-mediated post-transcriptional gene silencing (PTGS). No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0509300 Involved in the RNA silencing pathway.
The small interfering RNA production pathway is required for shoot meristem initiation in rice.2007 · DOI: 10.1073/pnas.0704339104
Oryza sativa dicer-like4 reveals a key role for small interfering RNA silencing in plant development.2007 · DOI: 10.1105/tpc.107.052209
Os01g0909200 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Os10g0485600 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_002782 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006353 DNA-templated transcription termination Biological Process
GO:0006995 cellular response to nitrogen starvation Biological Process
GO:0009616 RNAi-mediated antiviral immune response Biological Process
GO:0009944 polarity specification of adaxial/abaxial axis Biological Process
GO:0010050 vegetative phase change Biological Process
GO:0010267 ta-siRNA processing Biological Process
GO:0010492 maintenance of shoot apical meristem identity Biological Process
GO:0010599 lsiRNA processing Biological Process
GO:0030422 siRNA processing Biological Process
GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process
GO:0048608 reproductive structure development Biological Process
GO:0051214 RNAi-mediated antiviral immunity against RNA virus Biological Process
KEGG gene cross-reference
ath:AT3G03300
ath:AT5G20320
dosa:Os01g0909200
dosa:Os04g0509300
dosa:Os10g0485600
osa:4324864
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.760
Rank 1 · TkA01G421030 · TK1151
Cytoplasm0.265
Rank 2 · TkA01G421030 · TK1151
Cell membrane0.048
Rank 3 · TkA01G421030 · TK1151
Endoplasmic reticulum0.029
Rank 4 · TkA01G421030 · TK1151
Mitochondrion0.025
Rank 5 · TkA01G421030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01695IstB_IS2140-93 aa
PF04851ResIII53-218 aa
PF00270DEAD55-217 aa
PF03368Dicer_dimer324-339 aa
PF00271Helicase_C399-516 aa
PF00636Ribonuclease_3405-440 aa
PF22590Cas3-like_C_2417-516 aa
PF03368Dicer_dimer583-667 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G421030PF01695IstB_IS2140930.05213.8
TkA01G421030PF04851ResIII532181.5e-1661.5
TkA01G421030PF00270DEAD552172.6e-2073.5
TkA01G421030PF03368Dicer_dimer3243391.4e-2486.7
TkA01G421030PF00271Helicase_C3995162.7e-1866.9
TkA01G421030PF00636Ribonuclease_34054408.8e-40136.3
TkA01G421030PF22590Cas3-like_C_24175160.0006820.6
TkA01G421030PF03368Dicer_dimer5836671.4e-2486.7
TkA01G421030PF00035dsrm5846531.3e-1248.9
TkA01G421030PF02170PAZ9029930.0005620.6
TkA01G421030PF14622Ribonucleas_3_3103910973.6e-2899.0
TkA01G421030PF00636Ribonuclease_3104011728.8e-40136.3
TkA01G421030PF14622Ribonucleas_3_3115311813.6e-2899.0
TkA01G421030PF14622Ribonucleas_3_3122713603.6e-2899.0
TkA01G421030PF00636Ribonuclease_3124813588.8e-40136.3
TkA01G421030PF14709DND1_DSRM138513992.2e-1660.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P84634Arabidopsis thalianasp|P84634|DCL4_ARATH Dicer-like protein 450.900%Swiss-ProtHigh
Q3EBC8Arabidopsis thalianasp|Q3EBC8|DCL2_ARATH Endoribonuclease Dicer homolog 233.200%Swiss-ProtMedium
A7LFZ6Oryza sativa subsp. japonicasp|A7LFZ6|DCL4_ORYSJ Endoribonuclease Dicer homolog 446.900%Swiss-ProtMedium
Q5N870Oryza sativa subsp. japonicasp|Q5N870|DCL3A_ORYSJ Endoribonuclease Dicer homolog 3a32.500%Swiss-ProtMedium
Q7XD96Oryza sativa subsp. japonicasp|Q7XD96|DCL3B_ORYSJ Endoribonuclease Dicer homolog 3b31.100%Swiss-ProtMedium

JBrowse

View in Genome Browser