TkA01G410650 | RubberDandelionOmics

Gene overview

TkA01G410650

Reference: TK1151 Chr: Chr01 Coordinates: 102440079-102444830 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2466 bp · TkA01G410650|TK1151|cDNA

CGTGGGGTTCCCCTTGTATTTATAGGAATTTTTGTGGTAAAAATCTTTTTCCATAAAAAATTTGCTTTCTAAAAATGGTACTTGTTCATTACAAAGTTACGTGGCGGATCATAGAGACACGTAGGCGTGAAGGTTAGCGCGTGCTAACTCAGTTGCTTGCGAATCCTTTGGCTTCCCCTATCCGATCGATGCTTCTTCTCAACAACAAAAAGGAAAATCAAAACCGCAACGAGTGGGGTTTATGCTGGGGTTTTGAAGTT...

CDS

Download CDS FASTA

1602 bp · TkA01G410650|TK1151|CDS

ATGTTTAGAAGCAACAATTTAACAGCAAGGATATTTGAGCGTCAGATTCGAACTCCTTCTCCTGGTACCACTATTCACCGTGCGAGGAGATTTTACGAGAATATAGTTCCCGGATCAACAATATACGATGTTGAATGTCCGGACCATTCATTCCGCAAGTTCACAGAAGATGGGAAATACCTGATAAGTTTTAGTAGAAACCATCAAGACTTGATTGTTTATCGGCCCACATGGCTTTCGTTTTCATGCAAAAATGAAGA...

Protein

Download Protein FASTA

533 aa · TkA01G410650|TK1151|PROTEIN

MFRSNNLTARIFERQIRTPSPGTTIHRARRFYENIVPGSTIYDVECPDHSFRKFTEDGKYLISFSRNHQDLIVYRPTWLSFSCKNEECDAQHLPPKANKFESFFTQLYTVPLASASELICKDFFLYAESNQFGLFATSTAQIYDAPPTGGAIQGVPSIEKITFHLLRLEDGVVLDERVFCNDYINLAHSMGVFLYDDLLAIVSLRYQHIHILQIRDSGTLVDVRAIGDFCREDDQLFLNSSSQGMSNIENSISQHIPVNN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G410650`
TK1151 ID	TkA01G410650
OH-1004 ID	LXL04_003004
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G410650

Location Chr01:102440079-102444830 (-)

Description Similar to DET1: Light-mediated development protein DET1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10180`	Component of light signal transduction machinery.	Arabidopsis COP10 forms a complex with DDB1 and DET1 in vivo and enhances the activity of ubiquitin conjugating enzymes.2004 · DOI: 10.1101/gad.1229504 DET1-mediated degradation of a SAGA-like deubiquitination module controls H2Bub homeostasis.2018 · DOI: 10.7554/elife.37892 DET1 represses a chloroplast blue light-responsive promoter in a developmental and tissue-specific manner in Arabidopsis thaliana.1998 · DOI: 10.1046/j.1365-313x.1998.00078.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003004 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006281 DNA repair Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0031461 cullin-RING ubiquitin ligase complex Cellular Component

GO:0031464 Cul4A-RING E3 ubiquitin ligase complex Cellular Component

GO:0080008 Cul4-RING E3 ubiquitin ligase complex Cellular Component

GO:0031625 ubiquitin protein ligase binding Molecular Function

KEGG gene cross-reference

ath:AT4G10180

hsa:55070

mmu:76375

sly:778329

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.566

Rank 1 · TkA01G410650 · TK1151

Nucleus0.257

Rank 2 · TkA01G410650 · TK1151

Cell membrane0.112

Rank 3 · TkA01G410650 · TK1151

Lysosome / Vacuole0.107

Rank 4 · TkA01G410650 · TK1151

Golgi apparatus0.093

Rank 5 · TkA01G410650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09737Det1121-533 aa

PF00621RhoGEF366-427 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G410650	`PF09737`	Det1	121	533	5.1e-144	481.1
TkA01G410650	`PF00621`	RhoGEF	366	427	0.6	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P48732`	Arabidopsis thaliana	sp\|P48732\|DET1_ARATH Light-mediated development protein DET1	69.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card