TkA01G401350 | RubberDandelionOmics

Gene overview

TkA01G401350

Reference: TK1151 Chr: Chr01 Coordinates: 100268838-100276130 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4594 bp · TkA01G401350|TK1151|cDNA

TGGGACCCTTCCAAAAGACACATCAGTAGCTGTCTGCACAATTGAAAAAGCAAATTCACTTCTCAACAGATTACTTGAAGAAGGGCGGTTATCAGAAGTTGGAATCATAGTAATTGATGAACTTCACATGGTTGGAGATCAACATAGAGGGTATCTACTAGAACTCATGTTGACAAAGCTTAGATATGGAGTGGTGAAGGGAGGGTAGAAGTGTCAAGTGGGGAAAGTTCAGGGTCAAGTAGTGGAAAAATGGACCCCAC...

CDS

Download CDS FASTA

3426 bp · TkA01G401350|TK1151|CDS

ATGTCTGGGCGGGCGGGCCGTACAGGGATTGACACAAAAGGAGAGAGTGTGCTAGTATGCAAACCCGAAGAAGTAAAAAGAATCACGTCCCTCATCACCGATTCCATTCCACCACTTCATTCCTGTCTATCAGAAGACAAGAACGGAATGACACACGCCATTTTGGAAGTCGTCGCAGGCGGAATCGTCCAAACCGCAAACGACATCCACAGATACGTAAGATGCACGCTTCTCAATTCCACACAACCGTTTCAAGATGT...

Protein

Download Protein FASTA

1141 aa · TkA01G401350|TK1151|PROTEIN

MSGRAGRTGIDTKGESVLVCKPEEVKRITSLITDSIPPLHSCLSEDKNGMTHAILEVVAGGIVQTANDIHRYVRCTLLNSTQPFQDVVKSATDSLKWLCHRKFLEWSEDTKLYNVTPLGHACFGSSLCPQESLVVLDDLSRAREGFVLASDLHLVYLVTPINVDLEPDWELYYERFMQLPALDQSVGNRVGVQEPFLMRMAHGGPTRTFDKSKRDIKGLGVSTNKNLTHDQMLRVCKRFYVALILSRLVQETPVIEVCEG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G401350`
TK1151 ID	TkA01G401350
OH-1004 ID	LXL04_005681
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 59.582 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G401350

Location Chr01:100268838-100276130 (+)

Description Similar to TEB: Helicase and polymerase-containing protein TEBICHI

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32700`	Required for regulated cell division and differentiation in meristems and embryos, thus modulating adaxial-abaxial polarity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005681 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0031297 replication fork processing Biological Process

GO:0042276 error-prone translesion synthesis Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0051301 cell division Biological Process

KEGG gene cross-reference

ath:AT4G32700

hsa:10721

mmu:77782

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.487

Rank 1 · TkA01G401350 · TK1151

Cytoplasm0.311

Rank 2 · TkA01G401350 · TK1151

Mitochondrion0.163

Rank 3 · TkA01G401350 · TK1151

Plastid0.086

Rank 4 · TkA01G401350 · TK1151

Cell membrane0.039

Rank 5 · TkA01G401350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20470HTH_6114-105 aa

PF21099POLQ_helical129-305 aa

PF21280Helicase_dom4_arc234-308 aa

PF25453DUF7898312-385 aa

PF14520HHH_5315-351 aa

PF21099POLQ_helical604-695 aa

PF00476DNA_pol_A730-1133 aa

PF15454LAMTOR1022-1056 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G401350	`PF20470`	HTH_61	14	105	1.8e-27	96.2
TkA01G401350	`PF21099`	POLQ_helical	129	305	4.6e-54	183.6
TkA01G401350	`PF21280`	Helicase_dom4_arc	234	308	0.14	12.8
TkA01G401350	`PF25453`	DUF7898	312	385	4.2e-07	31.0
TkA01G401350	`PF14520`	HHH_5	315	351	0.05	14.8
TkA01G401350	`PF21099`	POLQ_helical	604	695	4.6e-54	183.6
TkA01G401350	`PF00476`	DNA_pol_A	730	1133	2.2e-108	363.3
TkA01G401350	`PF15454`	LAMTOR	1022	1056	0.061	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q588V7`	Arabidopsis thaliana	sp\|Q588V7\|TEB_ARATH Helicase and polymerase-containing protein TEBICHI	61.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card