TkA01G384790 | RubberDandelionOmics

Gene overview

TkA01G384790

Reference: TK1151 Chr: Chr01 Coordinates: 96044322-96049072 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1308 bp · TkA01G384790|TK1151|cDNA

TTAGTCTTTCCCTCCCAAAGTTCCGAAACCCTAACCCTTCAACCAGCGAGGCGGAGCCGTGAGTCTGTGACGACTAGCATCTCCATCATCAATTCAGGCATGAAGAACACCAAACGAACAAAGGCATCAAAACGGGAAGATGGGGTTGATTTGATCAGTAACATGCCGGATGCTATTCTTGTTTTGATTCTTTCATGTCTTTCATCCATTGAAGAACAAATCCGAACCAGCATTTTGTCCCGACGATGGAGGTATTTGTG...

CDS

Download CDS FASTA

765 bp · TkA01G384790|TK1151|CDS

TTAGTCTTTCCCTCCCAAAGTTCCGAAACCCTAACCCTTCAACCAGCGAGGCGGAGCCGTGAGTCTGTGACGACTAGCATCTCCATCATCAATTCAGGCATGAAGAACACCAAACGAACAAAGGCATCAAAACGGGAAGATGGGGTTGATTTGATCAGTAACATGCCGGATGCTATTCTTGTTTTGATTCTTTCATGTCTTTCATCCATTGAAGAACAAATCCGAACCAGCATTTTGTCCCGACGATGGAGGTATTTGTG...

Protein

Download Protein FASTA

254 aa · TkA01G384790|TK1151|PROTEIN

LVFPSQSSETLTLQPARRSRESVTTSISIINSGMKNTKRTKASKREDGVDLISNMPDAILVLILSCLSSIEEQIRTSILSRRWRYLWTAVPSLRLQFVSRRKINKKREFKEFTYWVLASKTVDLDSFRLRLNNDYSMSTIWRWVHLAVMRNVKQLDLSFRIKEETETIDLPRYLVNCDSLEVLRLDLMKSNVSLPRFVGFSALKVLDLTEADLPEDDDLVNDFLKSCPLLEDLSLVGSLLGETCLYFISKSQEA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G384790`
TK1151 ID	TkA01G384790
OH-1004 ID	LXL04_003216
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.600
Protein coverage (%)	TK1151 80.315 / OH-1004 12.085 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G384790

Location Chr01:96044322-96049072 (-)

Description Similar to FBL13: F-box/LRR-repeat protein 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56370`	FBD-associated F-box protein At5g56370.	No verified direct reference in this release
`At2g26860`	FBD-associated F-box protein At2g26860.	No verified direct reference in this release
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release
`At1g66290`	Putative F-box/FBD/LRR-repeat protein At1g66290.	No verified direct reference in this release
`At3g52680`	F-box/FBD/LRR-repeat protein At3g52680.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003216 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G69630

ath:AT3G52680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.854

Rank 1 · TkA01G384790 · TK1151

Cytoplasm0.165

Rank 2 · TkA01G384790 · TK1151

Cell membrane0.047

Rank 3 · TkA01G384790 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA01G384790 · TK1151

Plastid0.023

Rank 5 · TkA01G384790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23622LRR_At1g61320_AtMIF134-86 aa

PF00646F-box52-92 aa

PF12937F-box-like52-86 aa

PF23622LRR_At1g61320_AtMIF1120-236 aa

PF24758LRR_At5g56370142-251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G384790	`PF23622`	LRR_At1g61320_AtMIF1	34	86	0.0029	17.8
TkA01G384790	`PF00646`	F-box	52	92	7e-07	29.6
TkA01G384790	`PF12937`	F-box-like	52	86	0.00062	20.2
TkA01G384790	`PF23622`	LRR_At1g61320_AtMIF1	120	236	0.0029	17.8
TkA01G384790	`PF24758`	LRR_At5g56370	142	251	3.9e-11	43.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FM94`	Arabidopsis thaliana	sp\|Q9FM94\|FBD21_ARATH FBD-associated F-box protein At5g56370	35.400%	Swiss-Prot	Medium
`Q84X02`	Arabidopsis thaliana	sp\|Q84X02\|FBD7_ARATH FBD-associated F-box protein At2g26860	34.000%	Swiss-Prot	Medium
`Q9FM89`	Arabidopsis thaliana	sp\|Q9FM89\|FDL38_ARATH F-box/FBD/LRR-repeat protein At5g56420	34.200%	Swiss-Prot	Medium
`Q9C8Y8`	Arabidopsis thaliana	sp\|Q9C8Y8\|FDL7_ARATH Putative F-box/FBD/LRR-repeat protein At1g66290	32.700%	Swiss-Prot	Medium
`Q9LXJ6`	Arabidopsis thaliana	sp\|Q9LXJ6\|FDL21_ARATH F-box/FBD/LRR-repeat protein At3g52680	35.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card