TkA01G383790 | RubberDandelionOmics

Gene overview

TkA01G383790

Reference: TK1151 Chr: Chr01 Coordinates: 95793376-95795297 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · TkA01G383790|TK1151|cDNA

TTCGTGTATCAATTTCGCATGGCTACGGTATTTCAACAATAAACCCGTGGATTCACGCCACCGTTATGAGAAACGTCAAACAACTTGACTTGAAGTTTGCTTCCGATTGGGAGTCTGAGGAGATGGTGATGCCCCACTGCGCTTCGTTGGAGACAAATTGGATCGTCTTTGTATTTCATGCCCAAATCTCAAGAAGCTGAAAATTTCCAACGGCGACGTGCGTGATTGTATTAAGATCTATTGCCCAAAACTGGTGTTCA...

CDS

Download CDS FASTA

1284 bp · TkA01G383790|TK1151|CDS

ATGAAGAAATCCAACAGGAGAAAGGCATCAAAACATGAGGATGAGGACATGGCTGATTTGATTAGCAACTTGCCAGATCACATCCTTCTTTTGATTCTCTCGGGACTTCCATCTACCGAAGAAATAATCCGAACAAGCATTTTGTCCAGGCGATGGAGGTATTTGTGGAATTCAATTCCCTCTCTAGACTTGGTATATCCCGGAGGATGGAAGCACTCAAGAATATCGAACTATAGCAAATTCAAAGAATTTGTTGACTG...

Protein

Download Protein FASTA

427 aa · TkA01G383790|TK1151|PROTEIN

MKKSNRRKASKHEDEDMADLISNLPDHILLLILSGLPSTEEIIRTSILSRRWRYLWNSIPSLDLVYPGGWKHSRISNYSKFKEFVDWVLLNRCADLDSFRVSISHGYGISTINPWIHATVMRNVKQLDLKFASDWESEEMVMPHCASLEVLSLCCTNRRLIFPRSSGFPSLRVLKLQFVELLDSDSVKDFLENCIMLEDLTLDTCRLDKLDRLCISCPNLKKLKISNGDVRDCIKIYCPKLVFMELIAVTTTQFIVERID...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G383790`
TK1151 ID	TkA01G383790
OH-1004 ID	LXL04_003230
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	55.400
Protein coverage (%)	TK1151 96.721 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G383790

Location Chr01:95793376-95795297 (-)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10400`	FBD-associated F-box protein At4g10400.	No verified direct reference in this release
`At1g78760`	Putative F-box/FBD/LRR-repeat protein At1g78760.	No verified direct reference in this release
`At1g78750`	F-box/FBD/LRR-repeat protein At1g78750.	No verified direct reference in this release
`At1g69630`	F-box/LRR-repeat protein 13.	No verified direct reference in this release
`At1g16940`	Putative F-box/FBD/LRR-repeat protein At1g16940.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003230 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT4G10400

ath:AT4G15060

ath:AT5G02700

ath:AT5G56690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.779

Rank 1 · TkA01G383790 · TK1151

Cytoplasm0.258

Rank 2 · TkA01G383790 · TK1151

Cell membrane0.052

Rank 3 · TkA01G383790 · TK1151

Endoplasmic reticulum0.048

Rank 4 · TkA01G383790 · TK1151

Plastid0.024

Rank 5 · TkA01G383790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23622LRR_At1g61320_AtMIF118-55 aa

PF00646F-box21-60 aa

PF12937F-box-like21-57 aa

PF23598LRR_1495-177 aa

PF23622LRR_At1g61320_AtMIF1107-347 aa

PF12799LRR_4110-129 aa

PF24758LRR_At5g56370114-241 aa

PF29594LRR_SKP2118-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G383790	`PF23622`	LRR_At1g61320_AtMIF1	18	55	7.5e-11	42.7
TkA01G383790	`PF00646`	F-box	21	60	6.8e-07	29.7
TkA01G383790	`PF12937`	F-box-like	21	57	5.7e-06	26.7
TkA01G383790	`PF23598`	LRR_14	95	177	0.0048	16.4
TkA01G383790	`PF23622`	LRR_At1g61320_AtMIF1	107	347	7.5e-11	42.7
TkA01G383790	`PF12799`	LRR_4	110	129	0.0093	16.9
TkA01G383790	`PF24758`	LRR_At5g56370	114	241	1.6e-13	51.5
TkA01G383790	`PF29594`	LRR_SKP2	118	208	0.088	12.8
TkA01G383790	`PF12799`	LRR_4	147	178	0.0093	16.9
TkA01G383790	`PF00646`	F-box	148	156	6.8e-07	29.7
TkA01G383790	`PF23598`	LRR_14	161	227	0.0048	16.4
TkA01G383790	`PF12799`	LRR_4	197	227	0.0093	16.9
TkA01G383790	`PF00646`	F-box	206	217	6.8e-07	29.7
TkA01G383790	`PF29594`	LRR_SKP2	208	234	0.088	12.8
TkA01G383790	`PF24758`	LRR_At5g56370	285	345	1.6e-13	51.5
TkA01G383790	`PF12799`	LRR_4	304	317	0.0093	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SV82`	Arabidopsis thaliana	sp\|Q9SV82\|FBD40_ARATH FBD-associated F-box protein At4g10400	30.500%	Swiss-Prot	Medium
`Q9ZV94`	Arabidopsis thaliana	sp\|Q9ZV94\|FDL11_ARATH Putative F-box/FBD/LRR-repeat protein At1g78760	26.700%	Swiss-Prot	Low
`Q9ZV93`	Arabidopsis thaliana	sp\|Q9ZV93\|FDL10_ARATH F-box/FBD/LRR-repeat protein At1g78750	27.600%	Swiss-Prot	Low
`Q9FWZ1`	Arabidopsis thaliana	sp\|Q9FWZ1\|FBL13_ARATH F-box/LRR-repeat protein 13	28.100%	Swiss-Prot	Low
`Q9FZ53`	Arabidopsis thaliana	sp\|Q9FZ53\|FDL4_ARATH Putative F-box/FBD/LRR-repeat protein At1g16940	24.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card