Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1815 bp · TkA01G375580|TK1151|cDNA
ACAGCTGAAAATTTGAAACTTTTATTAAAAGATATGGAAGCAACACTACAGAAAGGAAGGAAGTATTCTTTCCCTAATGGAATAAGCCGAGGCCATTTCAAATCTGATTTTGTTTGGGGTACTGCTACTTCTGCTTATCAGATTGAAGGTGCTGCATTTGAAGGTGGTAGACAACCGAGCATCTGGGATGCATTCTGCCTCAAAAAACCTGGGGCCATCGTTAATGGAGATAACGGAAACAAGGCTATCAATTCTTATTA...
1578 bp · TkA01G375580|TK1151|CDS
ATGGAAGCAACACTACAGAAAGGAAGGAAGTATTCTTTCCCTAATGGAATAAGCCGAGGCCATTTCAAATCTGATTTTGTTTGGGGTACTGCTACTTCTGCTTATCAGATTGAAGGTGCTGCATTTGAAGGTGGTAGACAACCGAGCATCTGGGATGCATTCTGCCTCAAAAAACCTGGGGCCATCGTTAATGGAGATAACGGAAACAAGGCTATCAATTCTTATTACAAGACCAAGGAAGATGTGCAATTAATGAAGAA...
Protein
Download Protein FASTA525 aa · TkA01G375580|TK1151|PROTEIN
MEATLQKGRKYSFPNGISRGHFKSDFVWGTATSAYQIEGAAFEGGRQPSIWDAFCLKKPGAIVNGDNGNKAINSYYKTKEDVQLMKKLGLNAYRFSISWSRILPGGKLSMGVNQEGVDFYNNLINELINNGIEPYITLWHWDTPNALEEDYMGFLSDKIIDDFADYAEFCFWEFGDRVKHWITLNEPHSYAAFGYAYGYHAPGRGGSESELALASGNNIGCRTPGGGAKTFDNKCLGNAAIEPYIVAHNLLLAHATAAEL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G375580 |
|---|---|
| TK1151 ID | TkA01G375580 |
| OH-1004 ID | LXL04_010053 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 59.500 |
| Protein coverage (%) | TK1151 98.857 / OH-1004 96.289Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G375580 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:93680069-93684295 (-) | |||||||||
| Description | Similar to BGLU24: Beta-glucosidase 24 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. Rice
| |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0005975 carbohydrate metabolic process Biological Process GO:0006952 defense response Biological Process GO:0051259 protein complex oligomerization Biological Process GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0004338 glucan exo-1,3-beta-glucosidase activity Molecular Function GO:0004565 beta-galactosidase activity Molecular Function GO:0008422 beta-glucosidase activity Molecular Function GO:0033907 beta-D-fucosidase activity Molecular Function GO:0047701 beta-L-arabinosidase activity Molecular Function GO:0080083 beta-gentiobiose beta-glucosidase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ag:AAL93619 dosa:Os04g0474500 dosa:Os06g0320200 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00232Glyco_hydro_120-516 aaPF00150Cellulase71-189 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G375580 | PF00232 | Glyco_hydro_1 | 20 | 516 | 1.6e-152 | 508.9 |
| TkA01G375580 | PF00150 | Cellulase | 71 | 189 | 0.0014 | 18.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.