TkA01G369720 | RubberDandelionOmics

Gene overview

TkA01G369720

Reference: TK1151 Chr: Chr01 Coordinates: 92120436-92126623 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1588 bp · TkA01G369720|TK1151|cDNA

GATCAACAGAATAAAAAAAGTTGGCATGAATCAGAATGTTGTTCTAGTGACCAATCAGATGGATTTGATTTGGGAGATGGAGGTGCTCTTTGGGATGTATTTAGGAGGGAAGATACTCCAAAACTTGAGGAATATCTTAAAAAACATTGTAGAGAGTTTAGACATGCCTTCTGTCTTCCACTGCAGCAGGTTATCCACCCAATTCATGACCAAACATTCTACTTAACCATGGATCATAAAAGGAAGCTCAAAGAAGAGTT...

CDS

Download CDS FASTA

1077 bp · TkA01G369720|TK1151|CDS

GATCAACAGAATAAAAAAAGTTGGCATGAATCAGAATGTTGTTCTAGTGACCAATCAGATGGATTTGATTTGGGAGATGGAGGTGCTCTTTGGGATGTATTTAGGAGGGAAGATACTCCAAAACTTGAGGAATATCTTAAAAAACATTGTAGAGAGTTTAGACATGCCTTCTGTCTTCCACTGCAGCAGGTTATCCACCCAATTCATGACCAAACATTCTACTTAACCATGGATCATAAAAGGAAGCTCAAAGAAGAGTT...

Protein

Download Protein FASTA

358 aa · TkA01G369720|TK1151|PROTEIN

DQQNKKSWHESECCSSDQSDGFDLGDGGALWDVFRREDTPKLEEYLKKHCREFRHAFCLPLQQVIHPIHDQTFYLTMDHKRKLKEEFGIEAWSFVQKVGDAVLIPAGCPHQVRNLKSCIKVALEFVSPEHVGECIRLTEDFRLLPQNHKAKEDKLEVKKMALYAVEAAVNDLEKFMPKNSQHPEDYQDHPNPQYDESCQCISDHNKVPVIEDQTLQNSENSATAEVGSQISCENVKTSQNTETHAGGEMRLEMDCEGLQT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G369720`
TK1151 ID	TkA01G369720
OH-1004 ID	LXL04_003356
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	87.500
Protein coverage (%)	TK1151 87.709 / OH-1004 27.265 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G369720

Location Chr01:92120436-92126623 (-)

Description Similar to JMJ25: Lysine-specific demethylase JMJ25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11950`	May function as histone H3 lysine demethylase and be involved in regulation of gene expression.	No verified direct reference in this release
`At3g07610`	Histone demethylase that demethylates 'Lys-9' (H3K9me) of histone H3 with a specific activity for H3K9me2 and H3K9me1.	Control of genic DNA methylation by a jmjC domain-containing protein in Arabidopsis thaliana.2008 · DOI: 10.1126/science.1150987 An Arabidopsis jmjC domain protein protects transcribed genes from DNA methylation at CHG sites.2009 · DOI: 10.1038/emboj.2009.59 Autocatalytic differentiation of epigenetic modifications within the Arabidopsis genome.2010 · DOI: 10.1038/emboj.2010.227 DNA methylation in an intron of the IBM1 histone demethylase gene stabilizes chromatin modification patterns.2012 · DOI: 10.1038/emboj.2012.141 IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis.2012 · DOI: 10.1093/nar/gks647 SHOOT GROWTH1 maintains Arabidopsis epigenomes by regulating IBM1.2014 · DOI: 10.1371/journal.pone.0084687 Demethylation of ERECTA receptor genes by IBM1 histone demethylase affects stomatal development.2016 · DOI: 10.1242/dev.129932 Contrasting epigenetic control of transgenes and endogenous genes promotes post-transcriptional transgene silencing in Arabidopsis.2021 · DOI: 10.1038/s41467-021-22995-3 The arabidopsis GyraseB3 contributes to transposon silencing by promoting histone deacetylation.2025 · DOI: 10.1093/nar/gkaf985
`At1g62310`	May function as histone H3 lysine demethylase and be involved in regulation of gene expression.	No verified direct reference in this release
`At4g00990`	Histone demethylase that demethylates 'Lys-9' (H3K9me) of histone H3 with a specific activity for H3K9me1 and H3K9me2.	JMJ27, an Arabidopsis H3K9 histone demethylase, modulates defense against Pseudomonas syringae and flowering time.2017 · DOI: 10.1111/tpj.13623 JMJ27-mediated histone H3K9 demethylation positively regulates drought-stress responses in Arabidopsis.2021 · DOI: 10.1111/nph.17593
`At4g21430`	May function as histone H3 lysine demethylase and be involved in regulation of gene expression (By similarity).	The Arabidopsis histone demethylase JMJ28 regulates CONSTANS by interacting with FBH transcription factors.2021 · DOI: 10.1093/plcell/koab014

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003356 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009555 pollen development Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009908 flower development Biological Process

GO:0010440 stomatal lineage progression Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048366 leaf development Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

KEGG gene cross-reference

ath:AT1G11950

ath:AT1G62310

ath:AT3G07610

ath:AT4G00990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.795

Rank 1 · TkA01G369720 · TK1151

Cytoplasm0.247

Rank 2 · TkA01G369720 · TK1151

Mitochondrion0.049

Rank 3 · TkA01G369720 · TK1151

Cell membrane0.049

Rank 4 · TkA01G369720 · TK1151

Endoplasmic reticulum0.027

Rank 5 · TkA01G369720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02373JmjC27-125 aa

PF08007JmjC_292-128 aa

PF07883Cupin_297-116 aa

PF21237Pus10_N_euk114-176 aa

PF23257DUF7071143-176 aa

PF02373JmjC170-210 aa

PF06040Adeno_E3194-261 aa

PF07883Cupin_2271-279 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G369720	`PF02373`	JmjC	27	125	3.5e-15	57.2
TkA01G369720	`PF08007`	JmjC_2	92	128	0.089	13.0
TkA01G369720	`PF07883`	Cupin_2	97	116	0.0047	17.3
TkA01G369720	`PF21237`	Pus10_N_euk	114	176	0.089	13.2
TkA01G369720	`PF23257`	DUF7071	143	176	0.07	13.6
TkA01G369720	`PF02373`	JmjC	170	210	3.5e-15	57.2
TkA01G369720	`PF06040`	Adeno_E3	194	261	0.28	12.1
TkA01G369720	`PF07883`	Cupin_2	271	279	0.0047	17.3
TkA01G369720	`PF21237`	Pus10_N_euk	306	333	0.089	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0SUU8`	Arabidopsis thaliana	sp\|C0SUU8\|JMJ26_ARATH Lysine-specific demethylase JMJ26	68.500%	Swiss-Prot	Low
`Q9SSE9`	Arabidopsis thaliana	sp\|Q9SSE9\|JMJ25_ARATH Lysine-specific demethylase JMJ25	70.700%	Swiss-Prot	Low
`C0SV12`	Arabidopsis thaliana	sp\|C0SV12\|JMJ29_ARATH Lysine-specific demethylase JMJ29	71.300%	Swiss-Prot	Low
`Q8VYB9`	Arabidopsis thaliana	sp\|Q8VYB9\|JMJ27_ARATH Lysine-specific demethylase JMJ27	61.300%	Swiss-Prot	Low
`Q8H1S7`	Arabidopsis thaliana	sp\|Q8H1S7\|JMJ28_ARATH Lysine-specific demethylase JMJ28	45.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card