TkA01G347390 | RubberDandelionOmics

Gene overview

TkA01G347390

Reference: TK1151 Chr: Chr01 Coordinates: 86286440-86292735 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3861 bp · TkA01G347390|TK1151|cDNA

GTATCGCACTAGTGAAAATGTATGTCTCACATGATGAGCAACACCTTTCTTCTTTGTTTATTTTTCTTGCTCATCGCCTCTTTTGTTCGTGGGGCGGGAAACTGGTTCTTCCGGGGAAAATAGAGCTCTTTCCTCCCTCCAAAAACCTCACTGCTACTTCAATTTGGAAACCCTAGTTACAATGTCTTACTAATCTTTGAAAATCCCCAAATTTCCCAAACCGAATGGCATTTTCTTCTCAATTGTTATCACCAAACGCC...

CDS

Download CDS FASTA

3339 bp · TkA01G347390|TK1151|CDS

ATGGCATTTTCTTCTCAATTGTTATCACCAAACGCCGATAACAAACAGAGAGAAAACGACGACGAAGAAGCACCGCTAGAGGAGCAGAAAGTACTGGCTCAATCGGAAGAAGATCATCGTCATAATCATCGTGAGGCGAGGTACGTCGCCCTTGACCTCGTCTACTCAGCAACATCCCCCTGCAGTGGTTACGCGTATGTCATGTCTAAGAAGGTGAAAGCTAGGAAATACGGCGTGCTAGGGGTTCATAAAGACGGCAT...

Protein

Download Protein FASTA

1112 aa · TkA01G347390|TK1151|PROTEIN

MAFSSQLLSPNADNKQRENDDEEAPLEEQKVLAQSEEDHRHNHREARYVALDLVYSATSPCSGYAYVMSKKVKARKYGVLGVHKDGISVDPKPTSPKPPVIYFYSRCRRRKRSDRFDNISGYDRFLLNSKAISAVRVKAEDVELNDVDGDVGSIGALVNCSNKKRKTSQELINLGLNSVSLDAPRLRESSRKPNRTDDTSASSGRRRSKNKDNKNVCQKNTGDAIEATEIDDTNKPTTNASRTKRWVRLTFDGVDPQKFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G347390`
TK1151 ID	TkA01G347390
OH-1004 ID	LXL04_003523
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G347390

Location Chr01:86286440-86292735 (+)

Description Similar to ATX2: Histone-lysine N-methyltransferase ATX2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05830`	Histone methyltransferase.	The highly similar Arabidopsis homologs of trithorax ATX1 and ATX2 encode proteins with divergent biochemical functions.2008 · DOI: 10.1105/tpc.107.056614 Combinatorial functions of diverse histone methylations in Arabidopsis thaliana flowering time regulation.2014 · DOI: 10.1111/nph.12493
`At2g31650`	May participate in target-gene transcriptional regulation and associated histone methylation.	Combinatorial functions of diverse histone methylations in Arabidopsis thaliana flowering time regulation.2014 · DOI: 10.1111/nph.12493 Arabidopsis homolog of trithorax1 (ATX1) is required for cell production, patterning, and morphogenesis in root development.2014 · DOI: 10.1093/jxb/eru355
`At5g53430`	Histone methyltransferase.	No verified direct reference in this release
`At4g27910`	Histone methyltransferase.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0134500`	Possesses histone H3 methyltransferase activity in vitro.	Trithorax group protein Oryza sativa Trithorax1 controls flowering time in rice via interaction with early heading date3.2014 · DOI: 10.1104/pp.113.228049

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003523 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010093 specification of floral organ identity Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

KEGG gene cross-reference

ath:AT1G05830

ath:AT2G31650

ath:AT4G27910

ath:AT5G53430

dosa:Os09g0134500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.920

Rank 1 · TkA01G347390 · TK1151

Cytoplasm0.111

Rank 2 · TkA01G347390 · TK1151

Cell membrane0.040

Rank 3 · TkA01G347390 · TK1151

Plastid0.019

Rank 4 · TkA01G347390 · TK1151

Endoplasmic reticulum0.018

Rank 5 · TkA01G347390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05965FYRC108-133 aa

PF21743PTM_DIR17_Tudor273-299 aa

PF18359Tudor_5273-303 aa

PF00855PWWP355-442 aa

PF00628PHD421-431 aa

PF05964FYRN492-549 aa

PF21743PTM_DIR17_Tudor553-568 aa

PF05965FYRC556-630 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G347390	`PF05965`	FYRC	108	133	6.6e-12	46.1
TkA01G347390	`PF21743`	PTM_DIR17_Tudor	273	299	9.2e-07	29.3
TkA01G347390	`PF18359`	Tudor_5	273	303	0.058	13.9
TkA01G347390	`PF00855`	PWWP	355	442	1.4e-16	61.4
TkA01G347390	`PF00628`	PHD	421	431	0.0001	22.9
TkA01G347390	`PF05964`	FYRN	492	549	3.7e-16	59.2
TkA01G347390	`PF21743`	PTM_DIR17_Tudor	553	568	9.2e-07	29.3
TkA01G347390	`PF05965`	FYRC	556	630	6.6e-12	46.1
TkA01G347390	`PF00130`	C1_1	648	686	0.019	15.5
TkA01G347390	`PF13832`	zf-HC5HC2H_2	649	683	1.5e-30	106.3
TkA01G347390	`PF13771`	zf-HC5HC2H	652	683	3.3e-20	72.8
TkA01G347390	`PF12368`	Rhodanese_C	652	682	3.8	8.6
TkA01G347390	`PF00628`	PHD	654	699	0.0001	22.9
TkA01G347390	`PF31197`	PHD_JHD1	654	682	0.0048	17.5
TkA01G347390	`PF20826`	PHD_5	654	700	0.0061	17.3
TkA01G347390	`PF14788`	EF-hand_10	658	674	0.16	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0CB22`	Arabidopsis thaliana	sp\|P0CB22\|ATX2_ARATH Histone-lysine N-methyltransferase ATX2	54.100%	Swiss-Prot	High
`Q9C5X4`	Arabidopsis thaliana	sp\|Q9C5X4\|ATX1_ARATH Histone H3-lysine(4) N-trimethyltransferase ATX1	53.900%	Swiss-Prot	High
`Q8GZ42`	Arabidopsis thaliana	sp\|Q8GZ42\|ATX5_ARATH Histone-lysine N-methyltransferase ATX5	34.600%	Swiss-Prot	Low
`Q9SUE7`	Arabidopsis thaliana	sp\|Q9SUE7\|ATX4_ARATH Histone-lysine N-methyltransferase ATX4	35.300%	Swiss-Prot	Low
`Q6K431`	Oryza sativa subsp. japonica	sp\|Q6K431\|TRX1_ORYSJ Histone-lysine N-methyltransferase TRX1	57.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card