TkA01G323090 | RubberDandelionOmics

Gene overview

TkA01G323090

Reference: TK1151 Chr: Chr01 Coordinates: 80383313-80387599 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2241 bp · TkA01G323090|TK1151|cDNA

ATGTCTAGCTCCAAAGCAGAAGAAGCTCCATTGGAGCCCGAAAACCCTGACGAAAACGACTCAGAATCCGAAGACATCCCAATAGAATCCTCGTCCTCATCGTCGGACTCGGACTCTGACTCCGACTCCGACTCCGACTACGAACCGCTGACTTACACCCGACCCGACGGAACGACGAAGCAGATCGATCCCTATGACTCAGACGCCGAAAACACGCCGGAAGTCAACATCCCCCGCTTCTCCAGAATCCTCAATTCGAA...

CDS

Download CDS FASTA

2241 bp · TkA01G323090|TK1151|CDS

ATGTCTAGCTCCAAAGCAGAAGAAGCTCCATTGGAGCCCGAAAACCCTGACGAAAACGACTCAGAATCCGAAGACATCCCAATAGAATCCTCGTCCTCATCGTCGGACTCGGACTCTGACTCCGACTCCGACTCCGACTACGAACCGCTGACTTACACCCGACCCGACGGAACGACGAAGCAGATCGATCCCTATGACTCAGACGCCGAAAACACGCCGGAAGTCAACATCCCCCGCTTCTCCAGAATCCTCAATTCGAA...

Protein

Download Protein FASTA

746 aa · TkA01G323090|TK1151|PROTEIN

MSSSKAEEAPLEPENPDENDSESEDIPIESSSSSSDSDSDSDSDSDYEPLTYTRPDGTTKQIDPYDSDAENTPEVNIPRFSRILNSKRLRKEEEEEELDVDYLDDLFDFPPDPENWKEEDLKELWADAPIAMTKPGWDPHDVDEDEVDIISEEIKAGRDPPIAPFYVPYRKPYPVIPDDHYDISNPKSVIEELDRIEEFLTWVSLIFEDGSSYEGTVWDDLAHGKGVYVAEQGLVRYEGEWLQNQMEGHGVVEVEIPQME...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G323090`
TK1151 ID	TkA01G323090
OH-1004 ID	LXL04_013133
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.800
Protein coverage (%)	TK1151 72.788 / OH-1004 37.129 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G323090

Location Chr01:80383313-80387599 (-)

Description Similar to TIC100: Protein TIC 100

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22640`	Involved in protein precursor import into chloroplasts.	EMB1211 is required for normal embryo development and influences chloroplast biogenesis in Arabidopsis.2010 · DOI: 10.1111/j.1399-3054.2010.01407.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013133 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0032502 developmental process Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT1G23540

ath:AT1G26150

ath:AT1G70460

ath:AT5G22640

ath:AT5G38560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.587

Rank 1 · TkA01G323090 · TK1151

Nucleus0.329

Rank 2 · TkA01G323090 · TK1151

Cell membrane0.197

Rank 3 · TkA01G323090 · TK1151

Endoplasmic reticulum0.066

Rank 4 · TkA01G323090 · TK1151

Mitochondrion0.061

Rank 5 · TkA01G323090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02493MORN51-59 aa

PF02493MORN213-229 aa

PF02493MORN237-251 aa

PF02493MORN333-349 aa

PF15917Piezo_TM25-28581-687 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G323090	`PF02493`	MORN	51	59	3.4e-11	43.0
TkA01G323090	`PF02493`	MORN	213	229	3.4e-11	43.0
TkA01G323090	`PF02493`	MORN	237	251	3.4e-11	43.0
TkA01G323090	`PF02493`	MORN	333	349	3.4e-11	43.0
TkA01G323090	`PF15917`	Piezo_TM25-28	581	687	9.6	5.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPR8`	Arabidopsis thaliana	sp\|Q8LPR8\|TI100_ARATH Protein TIC 100	67.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card