TkA01G322760 | RubberDandelionOmics

Gene overview

TkA01G322760

Reference: TK1151 Chr: Chr01 Coordinates: 80254611-80257919 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1255 bp · TkA01G322760|TK1151|cDNA

TCCCCTTCGGGTTTAACACCTTGCTATCCGGGTTCATATTCCTGAATGTGTGCAAGATTCCTTCCATTTATCTTCTTCCCAAACACAACCCCTGCAAATCGAAATAAAAAACAATACTGAAACTCTACTAAAACCTAAAGAATGTTGAGAGCTTCTTGTAATATACCATCAATAGCTTCCCCAGCTATCAGCATCTGCACTGTTAGACTCTCTCTCTTTCCAATCCTTAATCTTACACCTTCATCTTCAGCCCGAAGAAT...

CDS

Download CDS FASTA

888 bp · TkA01G322760|TK1151|CDS

ATGTTGAGAGCTTCTTGTAATATACCATCAATAGCTTCCCCAGCTATCAGCATCTGCACTGTTAGACTCTCTCTCTTTCCAATCCTTAATCTTACACCTTCATCTTCAGCCCGAAGAATCTCCACAATACCTGTTCCAGCACTTGCACAAACTCTTAATTATTCGACATCTTCTTTTAGTTTGAAGAGGATTCTGCGCGCCATGGACCTCCCAGCTCCGAGAGCTTCAGCATCATATAGTACTGGGAGTAATGATGTTGG...

Protein

Download Protein FASTA

295 aa · TkA01G322760|TK1151|PROTEIN

MLRASCNIPSIASPAISICTVRLSLFPILNLTPSSSARRISTIPVPALAQTLNYSTSSFSLKRILRAMDLPAPRASASYSTGSNDVGRELLVQHLLVKEEDQNILFELQKRVVRGEDLSDLAVEYSICPSKEEGGMLGWVRKGQMVPEFEEAAFSAPLNKVVKCKTQFGWHLLQVLSEREESVLADIQPEEFHAKLQDPDFLEDSQCVDVREPHEVELASLSGFQVLPLQQFGSWGPEVTTKLDPQKDTYVLCHHGVRSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G322760`
TK1151 ID	TkA01G322760
OH-1004 ID	LXL04_003554
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G322760

Location Chr01:80254611-80257919 (+)

Description Similar to At5g19370: Rhodanese-like/PpiC domain-containing protein 12, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19370`	Rhodanese-like/PpiC domain-containing protein 12, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003554 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003755 peptidyl-prolyl cis-trans isomerase activity Molecular Function

KEGG gene cross-reference

ath:AT5G19370

ecc:c4697

ecj:JW3748

eco:b3775

ecoc:C3026_20445

stm:STM3910

stt:t3388

sty:STY3647

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.964

Rank 1 · TkA01G322760 · TK1151

Mitochondrion0.065

Rank 2 · TkA01G322760 · TK1151

Cytoplasm0.023

Rank 3 · TkA01G322760 · TK1151

Nucleus0.020

Rank 4 · TkA01G322760 · TK1151

Peroxisome0.009

Rank 5 · TkA01G322760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13145Rotamase_291-181 aa

PF00639Rotamase100-175 aa

PF13616Rotamase_3107-177 aa

PF00581Rhodanese189-285 aa

PF30980STR4_M203-217 aa

PF30980STR4_M245-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G322760	`PF13145`	Rotamase_2	91	181	0.0014	20.1
TkA01G322760	`PF00639`	Rotamase	100	175	4.3e-14	54.0
TkA01G322760	`PF13616`	Rotamase_3	107	177	7.9e-16	59.3
TkA01G322760	`PF00581`	Rhodanese	189	285	5.3e-09	37.1
TkA01G322760	`PF30980`	STR4_M	203	217	0.061	13.8
TkA01G322760	`PF30980`	STR4_M	245	282	0.061	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93WI0`	Arabidopsis thaliana	sp\|Q93WI0\|STR12_ARATH Rhodanese-like/PpiC domain-containing protein 12, chloroplastic	52.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card