TkA01G261850 | RubberDandelionOmics

Gene overview

TkA01G261850

Reference: TK1151 Chr: Chr01 Coordinates: 65820613-65822100 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1440 bp · TkA01G261850|TK1151|cDNA

ATGGAAGACCTCAAAACTTTGAGAATGACGAAAAAATTACTCTTAATAGAGTTATCTGCTATTGAGCAGAAAATTAGTCTTTACGAAGACACAACAACGGTAACCTCTGTACCGGAACACGAAAGTGTACAAACAAAGGCTATTCCGAAGCAAACGACTCTCGGTAAAGAATCAACAAATCCGTTGACAGTTGAGGTTTTGCTAAAAAACCTACTAAAGGAGAAAACTACTCCACTTCCTCAAGGAACAAATAGTTTGTT...

CDS

Download CDS FASTA

1440 bp · TkA01G261850|TK1151|CDS

ATGGAAGACCTCAAAACTTTGAGAATGACGAAAAAATTACTCTTAATAGAGTTATCTGCTATTGAGCAGAAAATTAGTCTTTACGAAGACACAACAACGGTAACCTCTGTACCGGAACACGAAAGTGTACAAACAAAGGCTATTCCGAAGCAAACGACTCTCGGTAAAGAATCAACAAATCCGTTGACAGTTGAGGTTTTGCTAAAAAACCTACTAAAGGAGAAAACTACTCCACTTCCTCAAGGAACAAATAGTTTGTT...

Protein

Download Protein FASTA

479 aa · TkA01G261850|TK1151|PROTEIN

MEDLKTLRMTKKLLLIELSAIEQKISLYEDTTTVTSVPEHESVQTKAIPKQTTLGKESTNPLTVEVLLKNLLKEKTTPLPQGTNSLLVNTNPPTEGLSKMTILSSVHKPEKNTDLRPDYKKALKKPADKYYVIYSGPHAGIHTDLAIVETFCKIDKVTCRGFRTEESARLSQQVYQEEMAKPTNKRLLRPKTVKEKHRDQRFDNHHLEDIQEQQSLFRLKTLEASGTKLEANDLVHEKFYTTDKKTKSLFNFIEGADARL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G261850`
TK1151 ID	TkA01G261850
OH-1004 ID	LXL04_028771
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.300
Protein coverage (%)	TK1151 60.125 / OH-1004 94.481 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G261850`
Location	Chr01:65820613-65822100 (-)
Description	Similar to ORF VI: Transactivator/viroplasmin protein (Figwort mosaic virus (strain DxS)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028771` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0075525 viral translational termination-reinitiation Biological Process GO:0030430 host cell cytoplasm Cellular Component
KEGG gene cross-reference	vg:940158 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.476

Rank 1 · TkA01G261850 · TK1151

Nucleus0.435

Rank 2 · TkA01G261850 · TK1151

Mitochondrion0.080

Rank 3 · TkA01G261850 · TK1151

Cell membrane0.054

Rank 4 · TkA01G261850 · TK1151

Endoplasmic reticulum0.030

Rank 5 · TkA01G261850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28494GlyRS_ins_1171-217 aa

PF31029Cauli_VI_C228-437 aa

PF28494GlyRS_ins_1336-389 aa

PF28494GlyRS_ins_1411-442 aa

PF29858GP46_beta426-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G261850	`PF28494`	GlyRS_ins_1	171	217	0.36	12.4
TkA01G261850	`PF31029`	Cauli_VI_C	228	437	6.2e-56	190.0
TkA01G261850	`PF28494`	GlyRS_ins_1	336	389	0.36	12.4
TkA01G261850	`PF28494`	GlyRS_ins_1	411	442	0.36	12.4
TkA01G261850	`PF29858`	GP46_beta	426	447	0.47	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card