TkA01G222780 | RubberDandelionOmics

Gene overview

TkA01G222780

Reference: TK1151 Chr: Chr01 Coordinates: 56666438-56670196 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

639 bp · TkA01G222780|TK1151|cDNA

ATGGAGAATACTTCACTGGAATACCGATTGGAACTTGGCCTCCCCTTCAACGACTGTTCTTCCGATCCAATCCTTTTTCATACCGCCGATCTATCGGGACACGCTTGCACTGAACTCCGTCAGGAAGACTTTCGATACAAGGATTTCAGGATCAACTTCGTAGAGAGACACTTGAATGATGGAGACTTTGTGATTTTCAATCGACAACCGAGTCTGCATAAGATGTCTATAATGGGGCATAGGATTAAGATCATGCCATA...

CDS

Download CDS FASTA

639 bp · TkA01G222780|TK1151|CDS

ATGGAGAATACTTCACTGGAATACCGATTGGAACTTGGCCTCCCCTTCAACGACTGTTCTTCCGATCCAATCCTTTTTCATACCGCCGATCTATCGGGACACGCTTGCACTGAACTCCGTCAGGAAGACTTTCGATACAAGGATTTCAGGATCAACTTCGTAGAGAGACACTTGAATGATGGAGACTTTGTGATTTTCAATCGACAACCGAGTCTGCATAAGATGTCTATAATGGGGCATAGGATTAAGATCATGCCATA...

Protein

Download Protein FASTA

212 aa · TkA01G222780|TK1151|PROTEIN

MENTSLEYRLELGLPFNDCSSDPILFHTADLSGHACTELRQEDFRYKDFRINFVERHLNDGDFVIFNRQPSLHKMSIMGHRIKIMPYSTFRLNLPVTSPYNADFEADEMNMHVPQSFETRAERQMSVVHIEHGETTERGKPKVAGLSGPRLGTIDRKMKCETCMANMAECPGHFGHLELAKPMFHIGFMKTVLRGSQIQASPKNRPKKILDA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G222780`
TK1151 ID	TkA01G222780
OH-1004 ID	LXL04_031397
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.300
Protein coverage (%)	TK1151 42.453 / OH-1004 6.097 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G222780

Location Chr01:56666438-56670196 (+)

Description Similar to NRPB1: DNA-directed RNA polymerase II subunit RPB1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35800`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031397 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006367 transcription initiation at RNA polymerase II promoter Biological Process

GO:0006369 termination of RNA polymerase II transcription Biological Process

GO:0042789 mRNA transcription by RNA polymerase II Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0000791 euchromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005665 RNA polymerase II, core complex Cellular Component

GO:0005700 polytene chromosome Cellular Component

GO:0005703 polytene chromosome puff Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT4G35800

bta:282312

ddi:DDB_G0279193

dme:Dmel_CG1554

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.377

Rank 1 · TkA01G222780 · TK1151

Nucleus0.307

Rank 2 · TkA01G222780 · TK1151

Extracellular0.081

Rank 3 · TkA01G222780 · TK1151

Mitochondrion0.070

Rank 4 · TkA01G222780 · TK1151

Peroxisome0.050

Rank 5 · TkA01G222780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00623RNA_pol_Rpb1_250-124 aa

PF04997RNA_pol_Rpb1_1122-194 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G222780	`PF00623`	RNA_pol_Rpb1_2	50	124	1.3e-35	123.9
TkA01G222780	`PF04997`	RNA_pol_Rpb1_1	122	194	1.7e-24	87.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P18616`	Arabidopsis thaliana	sp\|P18616\|NRPB1_ARATH DNA-directed RNA polymerase II subunit RPB1	65.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card