TkA01G215350 | RubberDandelionOmics

Gene overview

TkA01G215350

Reference: TK1151 Chr: Chr01 Coordinates: 54878415-54881838 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2715 bp · TkA01G215350|TK1151|cDNA

ATGTCCTTCAAAAACCAGCCTACGGACTTAGATCAACAATGTTGGTTGTATGAGAGCAGAGGCACATACGGCATTGGAAATGCGTATAACGATAAAGATGAACCTGAAACCGGAACAAAATTGGCTGCTATCTTGGATAAACCATGGAAACCCCTCACCCGCAAAACTCAAGTTCCCCCTAGCGTTCTTAGCCCATACCGGTTCCTTGTTGCCATTAGATTGGTAGTACAGGTGTTGTTTCTATCATGGAGATTGCAAAA...

CDS

Download CDS FASTA

2715 bp · TkA01G215350|TK1151|CDS

ATGTCCTTCAAAAACCAGCCTACGGACTTAGATCAACAATGTTGGTTGTATGAGAGCAGAGGCACATACGGCATTGGAAATGCGTATAACGATAAAGATGAACCTGAAACCGGAACAAAATTGGCTGCTATCTTGGATAAACCATGGAAACCCCTCACCCGCAAAACTCAAGTTCCCCCTAGCGTTCTTAGCCCATACCGGTTCCTTGTTGCCATTAGATTGGTAGTACAGGTGTTGTTTCTATCATGGAGATTGCAAAA...

Protein

Download Protein FASTA

904 aa · TkA01G215350|TK1151|PROTEIN

MSFKNQPTDLDQQCWLYESRGTYGIGNAYNDKDEPETGTKLAAILDKPWKPLTRKTQVPPSVLSPYRFLVAIRLVVQVLFLSWRLQNPNFDAMWLWGISISCEIWFAISWLLDQLPKLNPINRATDLVALKDKFERKSPENPTGRSDLPGVDVFISTADPDKEPPLVTANTILSILAVEWPIEKVSIYISDDGGAILTFEAMAEAVEFGHLWVPFCRKHNIEPRNPESYFTQKTDPTKNKKRADFVKDHRWMKREYDEFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G215350`
TK1151 ID	TkA01G215350
OH-1004 ID	LXL04_004004
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 99.889 / OH-1004 95.208 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G215350

Location Chr01:54878415-54881838 (-)

Description Similar to CSLD1: Cellulose synthase-like protein D1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g33100`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release
`At3g03050`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	AtCSLD3, a cellulose synthase-like gene important for root hair growth in arabidopsis.2001 · DOI: 10.1104/pp.126.2.575

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YCI3`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release
`Os06g0336500`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release
`UniProt: A2YU42`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004004 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009833 plant-type primary cell wall biogenesis Biological Process

GO:0009846 pollen germination Biological Process

GO:0030244 cellulose biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0071669 plant-type cell wall organization or biogenesis Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G33100

ath:AT3G03050

dosa:Os06g0336500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.610

Rank 1 · TkA01G215350 · TK1151

Endoplasmic reticulum0.225

Rank 2 · TkA01G215350 · TK1151

Golgi apparatus0.138

Rank 3 · TkA01G215350 · TK1151

Cytoplasm0.129

Rank 4 · TkA01G215350 · TK1151

Lysosome / Vacuole0.061

Rank 5 · TkA01G215350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13641Glyco_tranf_2_3149-189 aa

PF03552Cellulose_synt151-898 aa

PF13632Glyco_trans_2_3401-484 aa

PF13632Glyco_trans_2_3603-723 aa

PF13641Glyco_tranf_2_3609-658 aa

PF13632Glyco_trans_2_3833-863 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G215350	`PF13641`	Glyco_tranf_2_3	149	189	0.044	14.2
TkA01G215350	`PF03552`	Cellulose_synt	151	898		1169.5
TkA01G215350	`PF13632`	Glyco_trans_2_3	401	484	4.1e-05	24.2
TkA01G215350	`PF13632`	Glyco_trans_2_3	603	723	4.1e-05	24.2
TkA01G215350	`PF13641`	Glyco_tranf_2_3	609	658	0.044	14.2
TkA01G215350	`PF13632`	Glyco_trans_2_3	833	863	4.1e-05	24.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49323`	Arabidopsis thaliana	sp\|O49323\|CSLD1_ARATH Cellulose synthase-like protein D1	74.600%	Swiss-Prot	High
`Q9M9M4`	Arabidopsis thaliana	sp\|Q9M9M4\|CSLD3_ARATH Cellulose synthase-like protein D3	68.800%	Swiss-Prot	High
`A2YCI3`	Oryza sativa subsp. indica	sp\|A2YCI3\|CSLD5_ORYSI Putative cellulose synthase-like protein D5	69.800%	Swiss-Prot	High
`Q5Z6E5`	Oryza sativa subsp. japonica	sp\|Q5Z6E5\|CSLD5_ORYSJ Cellulose synthase-like protein D5	69.800%	Swiss-Prot	High
`A2YU42`	Oryza sativa subsp. indica	sp\|A2YU42\|CSLD2_ORYSI Cellulose synthase-like protein D2	67.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card