TkA01G206730 | RubberDandelionOmics

Gene overview

TkA01G206730

Reference: TK1151 Chr: Chr01 Coordinates: 52631837-52638974 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1026 bp · TkA01G206730|TK1151|cDNA

ATGTCTTTGTGTTTACGTTATTTAAACATGAGAGGAGACGTAGTTGAAAGATTTATTGGGATTGCGCATGTAGCGGATACCATGGCTTTATCTCTTAAAAAAGCAATTTTTTTTTGGAAAAAGGAGCATTCATTAAGTCCATCCAAAATTCGAGTTCAAGGATATGATGGAACTAGCAATATGAAGGGTGATATCAAAGGACTTAAAACTTTGATCTTAAACGAAATTTCGTCTACATATTACGTTCAATGTTTTTCTCA...

CDS

Download CDS FASTA

1026 bp · TkA01G206730|TK1151|CDS

ATGTCTTTGTGTTTACGTTATTTAAACATGAGAGGAGACGTAGTTGAAAGATTTATTGGGATTGCGCATGTAGCGGATACCATGGCTTTATCTCTTAAAAAAGCAATTTTTTTTTGGAAAAAGGAGCATTCATTAAGTCCATCCAAAATTCGAGTTCAAGGATATGATGGAACTAGCAATATGAAGGGTGATATCAAAGGACTTAAAACTTTGATCTTAAACGAAATTTCGTCTACATATTACGTTCAATGTTTTTCTCA...

Protein

Download Protein FASTA

341 aa · TkA01G206730|TK1151|PROTEIN

MSLCLRYLNMRGDVVERFIGIAHVADTMALSLKKAIFFWKKEHSLSPSKIRVQGYDGTSNMKGDIKGLKTLILNEISSTYYVQCFSHQLQLTLVAVSNKNIDCGWLFETLTNLLNVIGVSCKRKEMLREAQSQKVAQAFTDGELESAKGLNQELSLGRPGDTRWGSHYKLIVNVISSCLVIYEVLDKIGDVSSSSDYRLKVDVVSYALESFDFIFIIHLMETIFGIANDLNNALQRKYQDIVNAMSFVTLTKERLQQIRD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G206730`
TK1151 ID	TkA01G206730
OH-1004 ID	LXL04_011141
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	47.300
Protein coverage (%)	TK1151 100.000 / OH-1004 16.238 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G206730`
Location	Chr01:52631837-52638974 (+)
Description	Similar to PI4KG7: Phosphatidylinositol 4-kinase gamma 7
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011141` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0046777 protein autophosphorylation Biological Process GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:0004430 1-phosphatidylinositol 4-kinase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0043424 protein histidine kinase binding Molecular Function
KEGG gene cross-reference	ath:AT1G13640 ath:AT1G26270 ath:AT2G03890 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.659

Rank 1 · TkA01G206730 · TK1151

Nucleus0.327

Rank 2 · TkA01G206730 · TK1151

Extracellular0.046

Rank 3 · TkA01G206730 · TK1151

Mitochondrion0.038

Rank 4 · TkA01G206730 · TK1151

Endoplasmic reticulum0.034

Rank 5 · TkA01G206730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14291DUF43711-67 aa

PF19036Fuz_longin_176-134 aa

PF19036Fuz_longin_1231-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G206730	`PF14291`	DUF4371	1	67	1.2e-22	81.4
TkA01G206730	`PF19036`	Fuz_longin_1	76	134	0.092	13.7
TkA01G206730	`PF19036`	Fuz_longin_1	231	260	0.092	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card