TkA01G205250 | RubberDandelionOmics

Gene overview

TkA01G205250

Reference: TK1151 Chr: Chr01 Coordinates: 52249393-52252039 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1883 bp · TkA01G205250|TK1151|cDNA

GGTTACTAATGCAAGTCACAAGAAGTTGGAGGTCGTAAAAACAATTATAAACCCATACTCTTTTTGATGTACATCCAAATTGACTCACGTGAACGGACGATGTATCTGCCACCTCCGCTCAATCTCCCAACCCTGAACCCTCTATATTTATTTCAGCTGCTGGTTGTAGTACGCAAGTGATTTACAGTCGATCGAGAGAGGAAGAAGAATAGAAAATGGGTACGGAAGTTGTGATGCTCCAACATGCTTCGATTGGTAAT...

CDS

Download CDS FASTA

822 bp · TkA01G205250|TK1151|CDS

ATGGGTACGGAAGTTGTGATGCTCCAACATGCTTCGATTGGTAATACTCCGGTGCCGAACCAGAGTTGCTGCAATAATGGACCTGGTTATGCCACACCGCTTGACGCCATGTCTGGTCCCAGAGAATCAATCATCTACGTCACTTGCGTCTACACCGGAACAGGAAAGGAAAAACCAGATTTCCTGGGAACAGTGGATGTCGATCCAACGTCGGAAACCTACTCGCAAGTCATCCACCGGCTCCCTATGCCTCATTTAGG...

Protein

Download Protein FASTA

273 aa · TkA01G205250|TK1151|PROTEIN

MGTEVVMLQHASIGNTPVPNQSCCNNGPGYATPLDAMSGPRESIIYVTCVYTGTGKEKPDFLGTVDVDPTSETYSQVIHRLPMPHLGDELHHSGWNACSSCYGDSKTSRRFLVLPALVSGRIYAIDTQKDPRAPTIHKAVEPIEISGKTGLAYPHTAHCLASGDIMVSCLGDKDGKAEGNGFLLLDSDFNVKGRWEKPGHSPLFGYDYWYQPRHNTMISTSWGAPAAFTKGFDLQDVSDGLYGRHLHVYNWPDGDLKQTI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G205250`
TK1151 ID	TkA01G205250
OH-1004 ID	LXL04_004079
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 96.703 / OH-1004 53.768 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G205250

Location Chr01:52249393-52252039 (-)

Description Similar to SBP1: Selenium-binding protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23800`	Selenium-binding protein 3.	No verified direct reference in this release
`At4g14040`	Required for the fusion of female gametophyte polar nuclei.	No verified direct reference in this release
`At4g14030`	Binds cadmium and mediates lower sensitivity to stress requiring glutathione (GSH) for tolerance (e.g. cadmium, selenate, and hydrogen peroxide excess).	The Arabidopsis putative selenium-binding protein family: expression study and characterization of SBP1 as a potential new player in cadmium detoxification processes.2008 · DOI: 10.1104/pp.107.114033 Arabidopsis putative selenium-binding protein1 expression is tightly linked to cellular sulfur demand and can reduce sensitivity to stresses requiring glutathione for tolerance.2009 · DOI: 10.1104/pp.109.144808 Biochemical and biophysical characterization of the selenium-binding and reducing site in Arabidopsis thaliana homologue to mammals selenium-binding protein 1.2014 · DOI: 10.1074/jbc.m114.571208

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004079 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000103 sulfate assimilation Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0015031 protein transport Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0071291 cellular response to selenium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G23800

ath:AT4G14030

ath:AT4G14040

xla:447027

xla:734446

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.707

Rank 1 · TkA01G205250 · TK1151

Nucleus0.219

Rank 2 · TkA01G205250 · TK1151

Mitochondrion0.135

Rank 3 · TkA01G205250 · TK1151

Cell membrane0.113

Rank 4 · TkA01G205250 · TK1151

Extracellular0.074

Rank 5 · TkA01G205250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05694SBP5624-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G205250	`PF05694`	SBP56	24	262	3.9e-110	369.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK38`	Arabidopsis thaliana	sp\|Q9LK38\|SEBP3_ARATH Selenium-binding protein 3	75.000%	Swiss-Prot	High
`Q93WN0`	Arabidopsis thaliana	sp\|Q93WN0\|SEBP2_ARATH Selenium-binding protein 2	66.800%	Swiss-Prot	High
`O23264`	Arabidopsis thaliana	sp\|O23264\|SEBP1_ARATH Selenium-binding protein 1	69.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card