TkA01G203010 | RubberDandelionOmics

Gene overview

TkA01G203010

Reference: TK1151 Chr: Chr01 Coordinates: 51697489-51700720 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

723 bp · TkA01G203010|TK1151|cDNA

ATGGCATCAGGTACAGATGAAGCTCTCGAGCATGCTGGCTCAGTTCTTTCAGCATTAAGTGAGAAGCTATATGTCATAAAAGGAGGTTGTGGAGCTGGAAGTGGTGTAAAGATGGTTAATCAACTGCTAGCTGGAGTTCATATAGCATCAGCAGCTGAAGCAATGGCTTTTGGAGCTCGATTGGGTTTGGATACAAGAATGTTGTTTGATGTCTTAAAAGATAGTGAAGGAACATCTTGGATGTTTGAGAATCGAGGTCC...

CDS

Download CDS FASTA

723 bp · TkA01G203010|TK1151|CDS

ATGGCATCAGGTACAGATGAAGCTCTCGAGCATGCTGGCTCAGTTCTTTCAGCATTAAGTGAGAAGCTATATGTCATAAAAGGAGGTTGTGGAGCTGGAAGTGGTGTAAAGATGGTTAATCAACTGCTAGCTGGAGTTCATATAGCATCAGCAGCTGAAGCAATGGCTTTTGGAGCTCGATTGGGTTTGGATACAAGAATGTTGTTTGATGTCTTAAAAGATAGTGAAGGAACATCTTGGATGTTTGAGAATCGAGGTCC...

Protein

Download Protein FASTA

240 aa · TkA01G203010|TK1151|PROTEIN

MASGTDEALEHAGSVLSALSEKLYVIKGGCGAGSGVKMVNQLLAGVHIASAAEAMAFGARLGLDTRMLFDVLKDSEGTSWMFENRGPHMVDNDYTPLSALDIFVKDLGIVARECASRKVPLHISTVALQLFLSGSASGWGRLDDSAVVKVYETLTGVKVEGKVGVISKTSALASLPSEWEVDPLDEIRKIDNNLKTLVVLDDDPLSLMYVILPVPLILFAGADTSVLFAESENSWVDATM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G203010`
TK1151 ID	TkA01G203010
OH-1004 ID	LXL04_007309
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G203010`
Location	Chr01:51697489-51700720 (-)
Description	Similar to ltnD: L-threonate dehydrogenase (Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_007309` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016054 organic acid catabolic process Biological Process GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function GO:0050661 NADP binding Molecular Function GO:0051287 NAD binding Molecular Function
KEGG gene cross-reference	eca:ECA4327 ecc:c3297 ecj:JW2706 eco:b2736 ecoc:C3026_15050 hin:HI_1010 reh:H16_A1562 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.483

Rank 1 · TkA01G203010 · TK1151

Peroxisome0.321

Rank 2 · TkA01G203010 · TK1151

Plastid0.231

Rank 3 · TkA01G203010 · TK1151

Nucleus0.158

Rank 4 · TkA01G203010 · TK1151

Mitochondrion0.067

Rank 5 · TkA01G203010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14833NAD_binding_1131-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G203010	`PF14833`	NAD_binding_11	31	151	4.1e-32	111.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card