TkA01G189850 | RubberDandelionOmics

Gene overview

TkA01G189850

Reference: TK1151 Chr: Chr01 Coordinates: 48650103-48651219 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

873 bp · TkA01G189850|TK1151|cDNA

ATGGCTTCCTCAAAGATACAAACATCCATTCTCTCTATTTTGGTTCCGTTTCTTTGCATTTCTGAAACCTTTGTTACCGGTCAATACACCAACTTTACCAAGTTACAATTGCCTCAGGGTGTCAAGGGATCTGGAGGACTCGCATTTAAGACAGATTCAAGCAAGGGGCCCTTTGTAACTACCCTTGATGGTAGGATTATGGAATGGATTAGCAATAACTCTAGTTTCGTGGATTTTGCATTACTTCACCAAATAGAACA...

CDS

Download CDS FASTA

873 bp · TkA01G189850|TK1151|CDS

ATGGCTTCCTCAAAGATACAAACATCCATTCTCTCTATTTTGGTTCCGTTTCTTTGCATTTCTGAAACCTTTGTTACCGGTCAATACACCAACTTTACCAAGTTACAATTGCCTCAGGGTGTCAAGGGATCTGGAGGACTCGCATTTAAGACAGATTCAAGCAAGGGGCCCTTTGTAACTACCCTTGATGGTAGGATTATGGAATGGATTAGCAATAACTCTAGTTTCGTGGATTTTGCATTACTTCACCAAATAGAACA...

Protein

Download Protein FASTA

290 aa · TkA01G189850|TK1151|PROTEIN

MASSKIQTSILSILVPFLCISETFVTGQYTNFTKLQLPQGVKGSGGLAFKTDSSKGPFVTTLDGRIMEWISNNSSFVDFALLHQIEQCDGVENPDMGCVPWSSSYGVDNDMTSGRIYFSDASLTYDLKDTTQPEFIPDASGRFMRYDDRATEKVSTLLSGLRGGGGPAVSHDGTFILISENRNDRITKYFPEGRYRDSAGVLLQVNGNPDKITRVEDREEFWVATTRIGYVRPKAIIVPEGVRFDKDGKVLQTVQFGNEY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G189850`
TK1151 ID	TkA01G189850
OH-1004 ID	LXL04_008761
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	43.700
Protein coverage (%)	TK1151 99.655 / OH-1004 99.697 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G189850`
Location	Chr01:48650103-48651219 (+)
Description	Similar to SSL12: Protein STRICTOSIDINE SYNTHASE-LIKE 12
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008761` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009611 response to wounding Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0009820 alkaloid metabolic process Biological Process GO:0009821 alkaloid biosynthetic process Biological Process GO:0035834 indole alkaloid metabolic process Biological Process GO:0051365 cellular response to potassium ion starvation Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005773 vacuole Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ag:CAA44208 ath:AT1G74000 ath:AT1G74020 ath:AT3G57030 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.591

Rank 1 · TkA01G189850 · TK1151

Endoplasmic reticulum0.112

Rank 2 · TkA01G189850 · TK1151

Cytoplasm0.110

Rank 3 · TkA01G189850 · TK1151

Lysosome / Vacuole0.107

Rank 4 · TkA01G189850 · TK1151

Cell membrane0.053

Rank 5 · TkA01G189850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08450SGL39-68 aa

PF20067SSL_N58-68 aa

PF03088Str_synth108-191 aa

PF20067SSL_N112-121 aa

PF08450SGL113-262 aa

PF20067SSL_N125-141 aa

PF03088Str_synth234-254 aa

PF20067SSL_N235-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G189850	`PF08450`	SGL	39	68	0.00069	20.0
TkA01G189850	`PF20067`	SSL_N	58	68	0.0039	17.7
TkA01G189850	`PF03088`	Str_synth	108	191	1.3e-14	54.7
TkA01G189850	`PF20067`	SSL_N	112	121	0.0039	17.7
TkA01G189850	`PF08450`	SGL	113	262	0.00069	20.0
TkA01G189850	`PF20067`	SSL_N	125	141	0.0039	17.7
TkA01G189850	`PF03088`	Str_synth	234	254	1.3e-14	54.7
TkA01G189850	`PF20067`	SSL_N	235	254	0.0039	17.7
TkA01G189850	`PF20067`	SSL_N	267	279	0.0039	17.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card