TkA01G180390 | RubberDandelionOmics

Gene overview

TkA01G180390

Reference: TK1151 Chr: Chr01 Coordinates: 46243590-46245950 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1367 bp · TkA01G180390|TK1151|cDNA

CACAAGCGCTCATCTGCTTTCCATCTGAATCTCTCTCTAAAATTCAATCGCCTGTTTCTCTCCCTTTTTTTGATTCTCCTCAATCTAGTCAAAATGGGAGAAGAGAAACCAAAGCCAATCGGTGGTGTGTGGCCTACCATTAAACCGTTTGTCAATGGCGGAGCATCTGGTATGCTTGCTACCTGTGTCATCCAACCCATCGATATGATCAAGGTGAGAATTCAGCTAGGTCAAGGATCTGCAGGTGATGTCACCAAGAC...

CDS

Download CDS FASTA

993 bp · TkA01G180390|TK1151|CDS

CACAAGCGCTCATCTGCTTTCCATCTGAATCTCTCTCTAAAATTCAATCGCCTGTTTCTCTCCCTTTTTTTGATTCTCCTCAATCTAGTCAAAATGGGAGAAGAGAAACCAAAGCCAATCGGTGGTGTGTGGCCTACCATTAAACCGTTTGTCAATGGCGGAGCATCTGGTATGCTTGCTACCTGTGTCATCCAACCCATCGATATGATCAAGGTGAGAATTCAGCTAGGTCAAGGATCTGCAGGTGATGTCACCAAGAC...

Protein

Download Protein FASTA

330 aa · TkA01G180390|TK1151|PROTEIN

HKRSSAFHLNLSLKFNRLFLSLFLILLNLVKMGEEKPKPIGGVWPTIKPFVNGGASGMLATCVIQPIDMIKVRIQLGQGSAGDVTKTMLKNEGIGAFYKGLSAGLLRQATYTTARLGTFRILTNKALEANDGKPLPLYQKALCGLTAGAIGACVGSPADLALIRMQADATLPLHQRRNYTNAFHALYRITADEGILALWKGAGPTVVRAMALNMGMLASYDQSVEFFKDNLGFGEAATIVGASSISGFFAAACSLPFDFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G180390`
TK1151 ID	TkA01G180390
OH-1004 ID	LXL04_004244
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 97.576 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G180390

Location Chr01:46243590-46245950 (-)

Description Similar to DTC: Mitochondrial dicarboxylate/tricarboxylate transporter DTC

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19760`	Catalyzes the transport of dicarboxylates, such as oxoglutarate, oxaloacetate, malate, and succinate, and of tricarboxylates, such as citrate, isocitrate, cis-aconitate, and trans-aconitate by a counter-exchange mechanism across the inner mitochondrial membrane.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004244 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006094 gluconeogenesis Biological Process

GO:0006835 dicarboxylic acid transport Biological Process

GO:0035674 tricarboxylic acid transmembrane transport Biological Process

GO:0043490 malate-aspartate shuttle Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G19760

bta:282523

hsa:8402

mmu:67863

ncr:NCU10732

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.944

Rank 1 · TkA01G180390 · TK1151

Cytoplasm0.037

Rank 2 · TkA01G180390 · TK1151

Nucleus0.028

Rank 3 · TkA01G180390 · TK1151

Cell membrane0.026

Rank 4 · TkA01G180390 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA01G180390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00153Mito_carr46-122 aa

PF00153Mito_carr134-229 aa

PF00153Mito_carr241-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G180390	`PF00153`	Mito_carr	46	122	1.6e-57	191.9
TkA01G180390	`PF00153`	Mito_carr	134	229	1.6e-57	191.9
TkA01G180390	`PF00153`	Mito_carr	241	324	1.6e-57	191.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5M0`	Arabidopsis thaliana	sp\|Q9C5M0\|DTC_ARATH Mitochondrial dicarboxylate/tricarboxylate transporter DTC	84.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card