RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G169260
Reference: TK1151 Chr: Chr01 Coordinates: 43413014-43416726 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1444 bp · TkA01G169260|TK1151|cDNA

CAATCTTATAATGAAGGTTGTTGATGTGTTTTCAGTCTTTCTTTTATTTCATACCTTAAAGTTACTAACTTTATGTCTTTATGTTCTTTATTGTATTGATCAGAGATAAAGAAAATCCAGGTCAGCGCACGGGATCATTTTCAAAGAATCTTTAATGATCATGAAAAGATTAAAATCCAGCTGGAAAATCAGAAGAAAGAACTTGAGCTCAGAGGCCATGAACTTGAGAAACGTGAAGTGGTCAATGAATATGAAAGAAA...

CDS

Download CDS FASTA

1917 bp · TkA01G169260|TK1151|CDS

ATGGAGGATTACATGGATCAAAGCTCTGGAGGAGACACCGACGGAAGTGATTCAGAAGTAGAGGAGTTCGTAGACAAATCCTATGAAGAACTCCAAAGTGGAAAACACAAAGTGAAATTATCAGACGACACTTTCACTTGCCCTTTCTGTCGCAACAAGAAAAAACGTGATTACCAATACAAAGAGCTACTCCAGCATGCAACAATGGTGGGCAAAACCAATTCACAAAAAAGAAACCCAAAAGACAAAGCAAACCACCT...

Protein

Download Protein FASTA

638 aa · TkA01G169260|TK1151|PROTEIN

MEDYMDQSSGGDTDGSDSEVEEFVDKSYEELQSGKHKVKLSDDTFTCPFCRNKKKRDYQYKELLQHATMVGKTNSQKRNPKDKANHLALVKFLQKDVSENSGPSKPPEETNHLANHDGDEMFVWPWKGIVVNLPTELKDGRFVGKSGSNMRDNLTARGFNPTRVHPLWNFRGHSGFAVVEFNKGWDGFNNAMSFEKAYEADHRGKRDWKVNDIKTDIYGWVARADDYKANNIIGEHLRKIGDLRTVADIMAEEVRMANSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G169260
TK1151 IDTkA01G169260
OH-1004 IDLXL04_021930
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)65.500
Protein coverage (%)TK1151 99.373 / OH-1004 58.050
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G169260
LocationChr01:43413014-43416726 (-)
DescriptionSimilar to IDN2: Protein INVOLVED IN DE NOVO 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g48670 Forms a complex with FDM1/IDNL1 and FDM2/IDNL2 that is required for RNA-directed DNA methylation (RdDM) and that functions at a downstream step of the RdDM pathway and downstream of small interfering RNA (siRNA) formation.
IDN1 and IDN2 are required for de novo DNA methylation in Arabidopsis thaliana.2009 · DOI: 10.1038/nsmb.1690
An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis.2010 · DOI: 10.1111/j.1365-313x.2010.04130.x
IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.2012 · DOI: 10.1371/journal.pgen.1002693
INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis.2012 · DOI: 10.1073/pnas.1206638109
IDN2 has a role downstream of siRNA formation in RNA-directed DNA methylation.2012 · DOI: 10.4161/epi.21237
A SWI/SNF chromatin-remodeling complex acts in noncoding RNA-mediated transcriptional silencing.2013 · DOI: 10.1016/j.molcel.2012.11.011
RNA-directed DNA methylation requires stepwise binding of silencing factors to long non-coding RNA.2014 · DOI: 10.1111/tpj.12563
Two Components of the RNA-Directed DNA Methylation Pathway Associate with MORC6 and Silence Loci Targeted by MORC6 in Arabidopsis.2016 · DOI: 10.1371/journal.pgen.1006026
At3g12550 Acts in association with FDM4 and FDM5 for RNA-directed DNA methylation (RdDM).
A subgroup of SGS3-like proteins act redundantly in RNA-directed DNA methylation.2012 · DOI: 10.1093/nar/gks034
At1g15910 Forms a complex with IDN2 and FDM2/IDNL2 that is required for RNA-directed DNA methylation (RdDM) and that functions at a downstream step of the RdDM pathway.
A subgroup of SGS3-like proteins act redundantly in RNA-directed DNA methylation.2012 · DOI: 10.1093/nar/gks034
IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.2012 · DOI: 10.1371/journal.pgen.1002693
INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis.2012 · DOI: 10.1073/pnas.1206638109
At1g13790 Acts in association with FDM3 and FDM5 for RNA-directed DNA methylation (RdDM).
A subgroup of SGS3-like proteins act redundantly in RNA-directed DNA methylation.2012 · DOI: 10.1093/nar/gks034
At4g00380 Forms a complex with IDN2 and FDM1/IDNL1 that is required for RNA-directed DNA methylation (RdDM) and that functions at a downstream step of the RdDM pathway.
A subgroup of SGS3-like proteins act redundantly in RNA-directed DNA methylation.2012 · DOI: 10.1093/nar/gks034
IDN2 and its paralogs form a complex required for RNA-directed DNA methylation.2012 · DOI: 10.1371/journal.pgen.1002693
INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis.2012 · DOI: 10.1073/pnas.1206638109

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_021930 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0010569 regulation of double-strand break repair via homologous recombination Biological Process
GO:0046686 response to cadmium ion Biological Process
GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0003677 DNA binding Molecular Function
GO:0003723 RNA binding Molecular Function
GO:0003725 double-stranded RNA binding Molecular Function
KEGG gene cross-reference
ath:AT1G15910
ath:AT3G12550
ath:AT3G48670
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.652
Rank 1 · TkA01G169260 · TK1151
Cytoplasm0.382
Rank 2 · TkA01G169260 · TK1151
Cell membrane0.053
Rank 3 · TkA01G169260 · TK1151
Endoplasmic reticulum0.028
Rank 4 · TkA01G169260 · TK1151
Mitochondrion0.012
Rank 5 · TkA01G169260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05129Zn_ribbon_Elf135-55 aa
PF05605zf-Di1943-68 aa
PF14690Zn_ribbon_ISL344-62 aa
PF03470zf-XS47-90 aa
PF03468XS119-228 aa
PF24430DUF7553267-286 aa
PF05129Zn_ribbon_Elf1305-338 aa
PF03469XH350-406 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G169260PF05129Zn_ribbon_Elf135550.1812.6
TkA01G169260PF05605zf-Di1943680.113.6
TkA01G169260PF14690Zn_ribbon_ISL344620.06614.3
TkA01G169260PF03470zf-XS47907.4e-1968.5
TkA01G169260PF03468XS1192281.7e-39135.4
TkA01G169260PF24430DUF75532672860.1213.7
TkA01G169260PF05129Zn_ribbon_Elf13053380.1812.6
TkA01G169260PF03469XH3504062.1e-54183.7
TkA01G169260PF03468XS3593951.7e-39135.4
TkA01G169260PF24430DUF75533744120.1213.7
TkA01G169260PF14723SSFA2_C3874627.17.0
TkA01G169260PF24430DUF75534494600.1213.7
TkA01G169260PF14723SSFA2_C4694967.17.0
TkA01G169260PF24430DUF75534794910.1213.7
TkA01G169260PF03469XH5056352.1e-54183.7
TkA01G169260PF24430DUF75535615960.1213.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8VZ79Arabidopsis thalianasp|Q8VZ79|IDN2_ARATH Protein INVOLVED IN DE NOVO 252.200%Swiss-ProtHigh
Q9LHB1Arabidopsis thalianasp|Q9LHB1|FDM3_ARATH Factor of DNA methylation 345.400%Swiss-ProtMedium
Q9S9P3Arabidopsis thalianasp|Q9S9P3|FDM1_ARATH Factor of DNA methylation 141.200%Swiss-ProtMedium
Q9LMH6Arabidopsis thalianasp|Q9LMH6|FDM4_ARATH Factor of DNA methylation 438.700%Swiss-ProtMedium
F4JH53Arabidopsis thalianasp|F4JH53|FDM2_ARATH Factor of DNA methylation 241.000%Swiss-ProtMedium

JBrowse

View in Genome Browser