TkA01G168830 | RubberDandelionOmics

Gene overview

TkA01G168830

Reference: TK1151 Chr: Chr01 Coordinates: 43295559-43297125 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

918 bp · TkA01G168830|TK1151|cDNA

CCGAAATCGGACATAGAGGGTTGAAGAGGGGTTTATGTGATTTGCTGTGAATCGTTTATCAAAGAAGAATGAGTGGGGGTGGGACTGCAGATTTCTACTACAGAGAAGCTCAGCGCCTTGGTTATGTTGCCCGCTCGGCGTTCAAGTTGCTCCAGATTCAGAAACAATACAAATTGATAACACCTGGTTCCTCTGTTCTTGACCTAGGTTGTGCTCCTGGTGCTTGGCTTCAGGTCGCTTGTCAAAGTCTCGGTCCATTG...

CDS

Download CDS FASTA

660 bp · TkA01G168830|TK1151|CDS

ATGAGTGGGGGTGGGACTGCAGATTTCTACTACAGAGAAGCTCAGCGCCTTGGTTATGTTGCCCGCTCGGCGTTCAAGTTGCTCCAGATTCAGAAACAATACAAATTGATAACACCTGGTTCCTCTGTTCTTGACCTAGGTTGTGCTCCTGGTGCTTGGCTTCAGGTCGCTTGTCAAAGTCTCGGTCCATTGAAAAACGGTGGTGCTGTTGTTGGCATTGATCTTAAGAAGGTGAAGGTCCCTTCTACTCATTGTGATTC...

Protein

Download Protein FASTA

219 aa · TkA01G168830|TK1151|PROTEIN

MSGGGTADFYYREAQRLGYVARSAFKLLQIQKQYKLITPGSSVLDLGCAPGAWLQVACQSLGPLKNGGAVVGIDLKKVKVPSTHCDSRVSTICADVMNFPKHELRNLSPQKKGFSVLLSDMCPLVSGITTRDAALSMELGMRALDLALGKTEEQPEKEDDVDIGVLKTGGHLIVKLLESEDTKELSKICKPLFRKSSWLRPKATRSNSREIYLICQDLH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G168830`
TK1151 ID	TkA01G168830
OH-1004 ID	LXL04_012372
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G168830`
Location	Chr01:43295559-43297125 (-)
Description	Similar to rlmE: Ribosomal RNA large subunit methyltransferase E
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012372` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001510 RNA methylation Biological Process GO:0005737 cytoplasm Cellular Component GO:0008173 RNA methyltransferase activity Molecular Function GO:0008650 rRNA (uridine-2'-O-)-methyltransferase activity Molecular Function
KEGG gene cross-reference	dal:Dalk_2957 dol:Dole_0372 hla:Hlac_0434 mja:MJ_1376 sfu:Sfum_0997 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.921

Rank 1 · TkA01G168830 · TK1151

Cytoplasm0.088

Rank 2 · TkA01G168830 · TK1151

Nucleus0.087

Rank 3 · TkA01G168830 · TK1151

Plastid0.016

Rank 4 · TkA01G168830 · TK1151

Cell membrane0.014

Rank 5 · TkA01G168830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01728FtsJ19-217 aa

PF07021MetW34-56 aa

PF13489Methyltransf_2337-78 aa

PF13847Methyltransf_3138-80 aa

PF13649Methyltransf_2543-101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G168830	`PF01728`	FtsJ	19	217	1.7e-40	139.6
TkA01G168830	`PF07021`	MetW	34	56	0.045	14.1
TkA01G168830	`PF13489`	Methyltransf_23	37	78	0.0077	16.7
TkA01G168830	`PF13847`	Methyltransf_31	38	80	0.00068	20.1
TkA01G168830	`PF13649`	Methyltransf_25	43	101	0.0035	18.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card