TkA01G141070 | RubberDandelionOmics

Gene overview

TkA01G141070

Reference: TK1151 Chr: Chr01 Coordinates: 35799509-35803591 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2719 bp · TkA01G141070|TK1151|cDNA

CAAACACTGTTTTCACTTTTCATTTAAGTTTTATAATAAGAAAAGCAGAAAAAAGTAAAAGTGTCTTCAAAGTGGAAACTACAAATTAAATATAATAAAATGAAAGGGGTATGAAGAAGGACGGAAGAAAACTTTCCATATATGTGGAATTTCGCAAAGCTTGCACCACACATATCCATTGAAGACATTGCTTATAAATTCTTGTAAGCATTTCGTCGAACACCTTCAGTGTCACACAGAAACGCCCTTATCAGGTGCTA...

CDS

Download CDS FASTA

2091 bp · TkA01G141070|TK1151|CDS

ATGTCATATGCTAATTCAAGATCCGTAAGATTTCAAGAGGATGATGAACTACCAAAGTACCAATCAATCAACGCCGACAATTTATTCAAAGTCAAATACAAAATACACGGAAAAGAAATTCCAGAAACAACAAGAATACCCGAAAAAAGAATCGAAAAACGGCCACGACCTTCCTTAAAATCCAAAGTCCTTTCAAGGGTATTCTCCGAAGATTACGAAAGAGTGAAGAAAAAAATATTGGACCCTCGAGGTCAAAGCAT...

Protein

Download Protein FASTA

696 aa · TkA01G141070|TK1151|PROTEIN

MSYANSRSVRFQEDDELPKYQSINADNLFKVKYKIHGKEIPETTRIPEKRIEKRPRPSLKSKVLSRVFSEDYERVKKKILDPRGQSIRKWNKVFLVACLVSLFVDPLFFYLPSVRKNACINIGFSLEVSLTIVRSIADVFYMIQIYIKFVTAYVAPSSRVFGRGELVIDSSKIAKRYIKGDLWIDFLAALPLPQLLIWIIIPSLSGSAMANTKNVLRFIIILQYVPRLYLIYPLTSQIVQSTGVVTETAWAGAAYNLMLY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G141070`
TK1151 ID	TkA01G141070
OH-1004 ID	LXL04_004501
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G141070

Location Chr01:35799509-35803591 (+)

Description Similar to CNGC15C: Protein CNGC15c

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28260`	Putative cyclic nucleotide-gated ion channel.	No verified direct reference in this release
`At2g24610`	Probable cyclic nucleotide-gated ion channel.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004501 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0009877 nodulation Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0051592 response to calcium ion Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0071249 cellular response to nitrate Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0005249 voltage-gated potassium channel activity Molecular Function

GO:0005262 calcium channel activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT2G24610

ath:AT2G28260

mtr:11433273

mtr:25487817

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.899

Rank 1 · TkA01G141070 · TK1151

Cytoplasm0.088

Rank 2 · TkA01G141070 · TK1151

Endoplasmic reticulum0.055

Rank 3 · TkA01G141070 · TK1151

Nucleus0.029

Rank 4 · TkA01G141070 · TK1151

Golgi apparatus0.021

Rank 5 · TkA01G141070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00520Ion_trans90-409 aa

PF00689Cation_ATPase_C90-115 aa

PF00689Cation_ATPase_C331-414 aa

PF00027cNMP_binding505-589 aa

PF00612IQ620-637 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G141070	`PF00520`	Ion_trans	90	409	1.7e-18	67.4
TkA01G141070	`PF00689`	Cation_ATPase_C	90	115	0.027	15.0
TkA01G141070	`PF00689`	Cation_ATPase_C	331	414	0.027	15.0
TkA01G141070	`PF00027`	cNMP_binding	505	589	1.6e-06	28.7
TkA01G141070	`PF00612`	IQ	620	637	0.068	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SL29`	Arabidopsis thaliana	sp\|Q9SL29\|CNG15_ARATH Putative cyclic nucleotide-gated ion channel 15	72.300%	Swiss-Prot	High
`Q9SJA4`	Arabidopsis thaliana	sp\|Q9SJA4\|CNG14_ARATH Probable cyclic nucleotide-gated ion channel 14	61.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card