TkA01G132810 | RubberDandelionOmics

Gene overview

TkA01G132810

Reference: TK1151 Chr: Chr01 Coordinates: 33615233-33616015 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

642 bp · TkA01G132810|TK1151|cDNA

ATGTCGTCTGATATGTCAACGGAGGAAGATGAAGATATGGCGAATTGTTTGATTATGTTGGCTCAAAGTGAATCGCCGGTGAAAGAGGAGAAATCCGATCAGATTCGGCAGAAAACAGAGAGGTTAAGCAGTCGGAGGTTTACGGAGATGGCCGCTACTACACCCGGTGGAAGAGCTGGTTTCTATGTCTACGAGTGCAAAACGTGTAACCGTACGTTTCCGTCGTTTCAAGCTTTAGGTGGACACAGAGCAAGTCATAA...

CDS

Download CDS FASTA

642 bp · TkA01G132810|TK1151|CDS

ATGTCGTCTGATATGTCAACGGAGGAAGATGAAGATATGGCGAATTGTTTGATTATGTTGGCTCAAAGTGAATCGCCGGTGAAAGAGGAGAAATCCGATCAGATTCGGCAGAAAACAGAGAGGTTAAGCAGTCGGAGGTTTACGGAGATGGCCGCTACTACACCCGGTGGAAGAGCTGGTTTCTATGTCTACGAGTGCAAAACGTGTAACCGTACGTTTCCGTCGTTTCAAGCTTTAGGTGGACACAGAGCAAGTCATAA...

Protein

Download Protein FASTA

213 aa · TkA01G132810|TK1151|PROTEIN

MSSDMSTEEDEDMANCLIMLAQSESPVKEEKSDQIRQKTERLSSRRFTEMAATTPGGRAGFYVYECKTCNRTFPSFQALGGHRASHKKPKMEYSEEDQHKVVVEDEENKTSSIISNNVQISPSSSPGFIQTGIINNNTKVKVHECSICGSEFLSGQALGGHMRKHRPTPPSINRTGISTNTDESSRNSMLSLDLNLPPPELVFTAPALVDCHY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G132810`
TK1151 ID	TkA01G132810
OH-1004 ID	LXL04_004576
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	73.500
Protein coverage (%)	TK1151 100.000 / OH-1004 80.997 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G132810

Location Chr01:33615233-33616015 (-)

Description Similar to ZAT5: Zinc finger protein ZAT5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28200`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At3g60580`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At3g19580`	Transcriptional repressor involved in the inhibition of plant growth under abiotic stress conditions.	Functional identification of an Arabidopsis snf4 ortholog by screening for heterologous multicopy suppressors of snf4 deficiency in yeast.2000 · DOI: 10.1046/j.1365-313x.2000.00809.x Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions.2004 · DOI: 10.1104/pp.104.046599 Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells.2008 · DOI: 10.1073/pnas.0711203105 Arabidopsis zinc-finger protein 2 is a negative regulator of ABA signaling during seed germination.2010 · DOI: 10.1016/j.jplph.2010.05.010 Arabidopsis Cys2/His2 zinc-finger proteins AZF1 and AZF2 negatively regulate abscisic acid-repressive and auxin-inducible genes under abiotic stress conditions.2011 · DOI: 10.1104/pp.111.182683 Gene network analysis and functional studies of senescence-associated genes reveal novel regulators of Arabidopsis leaf senescence.2012 · DOI: 10.1111/j.1744-7909.2012.01136.x
`At5g67450`	Transcriptional repressor involved in the inhibition of plant growth under abiotic stress conditions.	Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions.2004 · DOI: 10.1104/pp.104.046599 Arabidopsis Cys2/His2 zinc-finger proteins AZF1 and AZF2 negatively regulate abscisic acid-repressive and auxin-inducible genes under abiotic stress conditions.2011 · DOI: 10.1104/pp.111.182683

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004576 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010200 response to chitin Biological Process

GO:0010224 response to UV-B Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0071289 cellular response to nickel ion Biological Process

KEGG gene cross-reference

ath:AT2G28200

ath:AT2G37430

ath:AT3G53600

ath:AT3G60580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.980

Rank 1 · TkA01G132810 · TK1151

Cytoplasm0.070

Rank 2 · TkA01G132810 · TK1151

Cell membrane0.024

Rank 3 · TkA01G132810 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA01G132810 · TK1151

Plastid0.010

Rank 5 · TkA01G132810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17232Pep1_723-47 aa

PF27116YjiV_N29-29 aa

PF02150Zn_ribbon_RPB957-75 aa

PF27116YjiV_N61-151 aa

PF09723Zn_ribbon_862-79 aa

PF13912zf-C2H2_663-89 aa

PF13894zf-C2H2_464-86 aa

PF12756zf-C2H2_264-100 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G132810	`PF17232`	Pep1_7	23	47	0.79	11.0
TkA01G132810	`PF27116`	YjiV_N	29	29	0.008	17.6
TkA01G132810	`PF02150`	Zn_ribbon_RPB9	57	75	0.034	14.7
TkA01G132810	`PF27116`	YjiV_N	61	151	0.008	17.6
TkA01G132810	`PF09723`	Zn_ribbon_8	62	79	0.011	16.5
TkA01G132810	`PF13912`	zf-C2H2_6	63	89	3.3e-25	88.2
TkA01G132810	`PF13894`	zf-C2H2_4	64	86	5.4e-09	36.7
TkA01G132810	`PF12756`	zf-C2H2_2	64	100	0.00011	23.2
TkA01G132810	`PF00096`	zf-C2H2	64	86	0.00044	21.3
TkA01G132810	`PF12874`	zf-met	64	87	0.0056	17.7
TkA01G132810	`PF12171`	zf-C2H2_jaz	64	87	0.021	15.7
TkA01G132810	`PF18439`	zf_UBZ	64	77	0.048	14.0
TkA01G132810	`PF23320`	Zn_SUZ12	64	102	0.13	12.7
TkA01G132810	`PF23107`	Zf-C2H2_ZNF451_C	64	91	0.15	13.4
TkA01G132810	`PF17232`	Pep1_7	64	112	0.79	11.0
TkA01G132810	`PF13913`	zf-C2HC_2	65	73	0.1	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q681X4`	Arabidopsis thaliana	sp\|Q681X4\|ZAT5_ARATH Zinc finger protein ZAT5	42.400%	Swiss-Prot	Medium
`Q9M202`	Arabidopsis thaliana	sp\|Q9M202\|ZAT9_ARATH Zinc finger protein ZAT9	31.200%	Swiss-Prot	Medium
`Q9SSW2`	Arabidopsis thaliana	sp\|Q9SSW2\|AZF2_ARATH Zinc finger protein AZF2	32.200%	Swiss-Prot	Medium
`Q9SSW1`	Arabidopsis thaliana	sp\|Q9SSW1\|AZF1_ARATH Zinc finger protein AZF1	39.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card