TkA01G131170 | RubberDandelionOmics

Gene overview

TkA01G131170

Reference: TK1151 Chr: Chr01 Coordinates: 33164616-33167390 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2539 bp · TkA01G131170|TK1151|cDNA

GTTTGTTGTTTCTGATCTCTTATTCTCCTAAATATACAAAGATTTAAGCATTTTCTTTTCTTTTCAAGTGCAATCTATAGTTTCTTTAACAGCACAAATTGAATGCCCCACCCAACCAATCATACTATCACTTCGAAATAACAATCCTTACAAGTAGATTTCAAATCGCCGATACAGTGTATATCTAAGTAGTTGAAACTTGAAAGGCTTGAAACTCGCTCTCTGATAATTACGGTGCTAATGGCGAATCCGAAAATTAT...

CDS

Download CDS FASTA

1869 bp · TkA01G131170|TK1151|CDS

ATGGCGAATCCGAAAATTATTGCTTCTTTCATCTTCTCCCATCCCCTCAGCAAATTCAAAGGTAATTCTTCCATTCTTTCTTTGAAAGATCCTTCAAAAATTTTAGGCTTACGTACCGGAATATGTCTCCTCCAAACGATCTTAGCTCCGTTTCATTCAACTTCATCTTCCAATTGCCAATCTCAGCGTAATCATCCTCGATCTATGTTTGAGAAGATTACTAACCTTGATGATGCCCTTATACTGTTCGATGAAATGAC...

Protein

Download Protein FASTA

622 aa · TkA01G131170|TK1151|PROTEIN

MANPKIIASFIFSHPLSKFKGNSSILSLKDPSKILGLRTGICLLQTILAPFHSTSSSNCQSQRNHPRSMFEKITNLDDALILFDEMTQRQPLSSVLKFNQLLQAVTKMKHFASSVELFKQMNALRIPFTVYTINIVINCCCKMYRTTEGFALLGYGFKHAIEPNVFTFSTLLNGLILEDKALIAERFFKKLIKEELCDPDAVMYTTMIKGLCKCGINDKAIGLLKLMDERGCKPNVVTYSTIIDSLCKDEMVDDALKLFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G131170`
TK1151 ID	TkA01G131170
OH-1004 ID	LXL04_004599
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 48.875 / OH-1004 48.875 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G131170

Location Chr01:33164616-33167390 (-)

Description Similar to At1g12700: Putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12620`	Pentatricopeptide repeat-containing protein At1g12620.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004599 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0080156 mitochondrial mRNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G12700

ath:AT1G62930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.785

Rank 1 · TkA01G131170 · TK1151

Plastid0.103

Rank 2 · TkA01G131170 · TK1151

Nucleus0.044

Rank 3 · TkA01G131170 · TK1151

Cytoplasm0.040

Rank 4 · TkA01G131170 · TK1151

Cell membrane0.010

Rank 5 · TkA01G131170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29978ATP18_TPR23-56 aa

PF12308Noelin-145-108 aa

PF23276TPR_2459-121 aa

PF02840Prp1865-96 aa

PF23220HAT_Syf1_M65-122 aa

PF29070MSC6_N69-139 aa

PF13041PPR_273-89 aa

PF12854PPR_175-87 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G131170	`PF29978`	ATP18_TPR	23	56	4.6e-08	33.8
TkA01G131170	`PF12308`	Noelin-1	45	108	0.26	12.1
TkA01G131170	`PF23276`	TPR_24	59	121	7e-32	110.8
TkA01G131170	`PF02840`	Prp18	65	96	0.2	12.4
TkA01G131170	`PF23220`	HAT_Syf1_M	65	122	0.22	12.1
TkA01G131170	`PF29070`	MSC6_N	69	139	1.5e-25	90.8
TkA01G131170	`PF13041`	PPR_2	73	89	6.2e-150	488.0
TkA01G131170	`PF12854`	PPR_1	75	87	5.3e-123	401.1
TkA01G131170	`PF01535`	PPR	75	89	1.3e-90	292.2
TkA01G131170	`PF09454`	Vps23_core	76	105	0.053	14.2
TkA01G131170	`PF24760`	TPR_IF140_C	78	119	0.11	13.6
TkA01G131170	`PF13812`	PPR_3	82	142	1.1e-63	211.9
TkA01G131170	`PF13041`	PPR_2	95	142	6.2e-150	488.0
TkA01G131170	`PF17177`	PPR_long	97	280	6.8e-31	108.0
TkA01G131170	`PF01535`	PPR	98	122	1.3e-90	292.2
TkA01G131170	`PF29978`	ATP18_TPR	102	140	4.6e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASZ8`	Arabidopsis thaliana	sp\|Q9ASZ8\|PPR37_ARATH Pentatricopeptide repeat-containing protein At1g12620	35.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card