TkA01G128770 | RubberDandelionOmics

Gene overview

TkA01G128770

Reference: TK1151 Chr: Chr01 Coordinates: 32539946-32544334 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2180 bp · TkA01G128770|TK1151|cDNA

ACCAAACACACCTTGGAAACACCCCCAAAGAGTAATTCCTTTCAAACACGGTCCAAAAACGGCCAACGCATTTCCAAAGCCGTTTTCACCACATCGACATCAACATTTTTACATGACAACTTTACCCCCTCATTTGTTTTCGTTCGAGGAACATCCACCACTCTCTCTTCAACATATATATGTAAAGTTGTAAACATTACATATCTTCGGAAGTAGTACCAAGTTGCTCATCCTAATTCGGAATTCATGAATATCCCGAG...

CDS

Download CDS FASTA

726 bp · TkA01G128770|TK1151|CDS

ATGGTTTATTATTGTGGTAATCCAGTTGGAACTATTGCTGCTAATGATCCAAGTGATTCCAGCATTCTCAATTATGATCAAGTATGTATTCGTGACTTCATACCTTCTGGAAATAGCTTTCTTTTTGAAAGGAGAGTATATATTGTACGCAATTTCATCTTACATACCCTTCAATTACAGAGTTGGGAGAAAACCATGGATTGTCATAGTCCAGGTCAAGGGTTAATGCCTGCAAGTTTTAAAGTCCGTACTGTTCCACT...

Protein

Download Protein FASTA

241 aa · TkA01G128770|TK1151|PROTEIN

MVYYCGNPVGTIAANDPSDSSILNYDQVCIRDFIPSGNSFLFERRVYIVRNFILHTLQLQSWEKTMDCHSPGQGLMPASFKVRTVPLDGDDSATEDILDPDFGEAAIGRVAPVDSGLWWIILLRAYGKCTGDLSVQERIDVQTGIKMILKLCLADGFDMFPTLLVTDGSCMIDRRMGIHGHPLEIQALFYSALLSAREMLTREDASADLMTALNNRLVALSFPREGILLDRHEKIKRNLQI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G128770`
TK1151 ID	TkA01G128770
OH-1004 ID	LXL04_004646
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.900
Protein coverage (%)	TK1151 92.116 / OH-1004 37.691 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G128770

Location Chr01:32539946-32544334 (-)

Description Similar to INVE: Alkaline/neutral invertase E, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22510`	Chloroplastic invertase that cleaves sucrose into glucose and fructose and is associated with the development of the photosynthetic apparatus and the assimilation of nitrogen in seedlings to control the sucrose to hexose ratio.	New insights on sucrose metabolism: evidence for an active A/N-Inv in chloroplasts uncovers a novel component of the intracellular carbon trafficking.2008 · DOI: 10.1007/s00425-007-0657-1
`At1g56560`	Mitochondrial invertase that cleaves sucrose into glucose and fructose and is involved in the regulation of multiple tissue development and floral transition.	Exploring the neutral invertase-oxidative stress defence connection in Arabidopsis thaliana.2011 · DOI: 10.1093/jxb/err069
`At3g06500`	Mitochondrial invertase that cleaves sucrose into glucose and fructose and is involved in the regulation of aerial tissue development and floral transition.	A mitochondrial alkaline/neutral invertase isoform (A/N-InvC) functions in developmental energy-demanding processes in Arabidopsis.2013 · DOI: 10.1007/s00425-012-1794-8
`At3g05820`	Chloroplastic invertase that cleaves sucrose into glucose and fructose and may participate in the carbon flux between the cytosol and plastids in leaves.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0529400`	Mitochondrial invertase that cleaves sucrose into glucose and fructose.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004646 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005982 starch metabolic process Biological Process

GO:0005987 sucrose catabolic process Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0048364 root development Biological Process

GO:0048825 cotyledon development Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004575 sucrose alpha-glucosidase activity Molecular Function

GO:0033926 endo-alpha-N-acetylgalactosaminidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G56560

ath:AT3G05820

ath:AT5G22510

dosa:Os02g0529400

dosa:Os03g0314800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.649

Rank 1 · TkA01G128770 · TK1151

Nucleus0.341

Rank 2 · TkA01G128770 · TK1151

Peroxisome0.099

Rank 3 · TkA01G128770 · TK1151

Mitochondrion0.097

Rank 4 · TkA01G128770 · TK1151

Cell membrane0.057

Rank 5 · TkA01G128770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12899Glyco_hydro_1001-222 aa

PF06202GDE_C179-202 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G128770	`PF12899`	Glyco_hydro_100	1	222	5.1e-92	309.6
TkA01G128770	`PF06202`	GDE_C	179	202	0.075	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FK88`	Arabidopsis thaliana	sp\|Q9FK88\|INVE_ARATH Alkaline/neutral invertase E, chloroplastic	84.400%	Swiss-Prot	High
`Q9FXA8`	Arabidopsis thaliana	sp\|Q9FXA8\|INVA_ARATH Alkaline/neutral invertase A, mitochondrial	77.500%	Swiss-Prot	High
`B9DFA8`	Arabidopsis thaliana	sp\|B9DFA8\|INVC_ARATH Alkaline/neutral invertase C, mitochondrial	75.700%	Swiss-Prot	High
`Q84JL5`	Arabidopsis thaliana	sp\|Q84JL5\|INVH_ARATH Probable alkaline/neutral invertase A, chloroplastic	73.100%	Swiss-Prot	High
`Q6H6N5`	Oryza sativa subsp. japonica	sp\|Q6H6N5\|NIN3_ORYSJ Neutral/alkaline invertase 3, chloroplastic	86.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card