TkA01G122440 | RubberDandelionOmics

Gene overview

TkA01G122440

Reference: TK1151 Chr: Chr01 Coordinates: 31024236-31026829 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1864 bp · TkA01G122440|TK1151|cDNA

ATTTCCTCCTTCTCGTTTATTCTTTCTGCTTTATCACAAAGTTAAACTTCGCTTTTACACTTTAGCTGCTACTAGTATTGCTACACAACAGTCTTGAGTTTTAAACCCTCAGATTTCCAGATATGGCCAACGAAAATCCCACCACCGCCGCTCCCGAAGCGGCGGCACAAGTCCAGAGCTCTCCACCACGCACCTCCACCTCAGACGAAACCCTAGATGCCGCACCACAACCACCACCATCACCTCCACCGCTAGTCTCT...

CDS

Download CDS FASTA

1512 bp · TkA01G122440|TK1151|CDS

ATGGCCAACGAAAATCCCACCACCGCCGCTCCCGAAGCGGCGGCACAAGTCCAGAGCTCTCCACCACGCACCTCCACCTCAGACGAAACCCTAGATGCCGCACCACAACCACCACCATCACCTCCACCGCTAGTCTCTGTAACTGAGAAAGATACCCCGCTCTCACTCCCTCTCATCTTGACATCCAAAGAAACAGATGTTTCACCACCATCGCCGCCGTCACCTTCCTCCACCACGGCTACAGCCAACACCACGTTGGG...

Protein

Download Protein FASTA

503 aa · TkA01G122440|TK1151|PROTEIN

MANENPTTAAPEAAAQVQSSPPRTSTSDETLDAAPQPPPSPPPLVSVTEKDTPLSLPLILTSKETDVSPPSPPSPSSTTATANTTLGEVIEQPERPDPKKIPQSMVSFKEESNRIKDLSGLEKVSLDEFKMLVQEAITNKDFAFSSTSEDPASEIKSNPDEISIWGIPLLKDERTDVILLKFLRARDFKVKDSFTMLKNTLRWRKAFSIDALVDENLGDDLEKVVFMHGYDTEGHPVCYNVYGEFQNKELYQKTFSDEEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G122440`
TK1151 ID	TkA01G122440
OH-1004 ID	LXL04_032941
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	78.400
Protein coverage (%)	TK1151 83.300 / OH-1004 89.278 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G122440

Location Chr01:31024236-31026829 (+)

Description Similar to PATL5: Patellin-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72160`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	No verified direct reference in this release
`At4g09160`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	No verified direct reference in this release
`At1g22530`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	No verified direct reference in this release
`At1g72150`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	Patellin1, a novel Sec14-like protein, localizes to the cell plate and binds phosphoinositides.2004 · DOI: 10.1104/pp.104.045369
`At3g51670`	Carrier protein that may be involved in membrane-trafficking events associated with cell-plate formation during cytokinesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032941 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009860 pollen tube growth Biological Process

GO:0051301 cell division Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

GO:1901703 protein localization involved in auxin polar transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G22530

ath:AT1G30690

ath:AT1G72150

ath:AT1G72160

ath:AT4G09160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.389

Rank 1 · TkA01G122440 · TK1151

Plastid0.176

Rank 2 · TkA01G122440 · TK1151

Nucleus0.170

Rank 3 · TkA01G122440 · TK1151

Cell membrane0.161

Rank 4 · TkA01G122440 · TK1151

Endoplasmic reticulum0.145

Rank 5 · TkA01G122440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30067CAF130_C123-172 aa

PF03765CRAL_TRIO_N127-199 aa

PF00650CRAL_TRIO223-383 aa

PF13716CRAL_TRIO_2310-388 aa

PF25099GOLD_PATL1_C407-491 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G122440	`PF30067`	CAF130_C	123	172	0.1	12.7
TkA01G122440	`PF03765`	CRAL_TRIO_N	127	199	2.6e-11	44.2
TkA01G122440	`PF00650`	CRAL_TRIO	223	383	1.1e-30	107.2
TkA01G122440	`PF13716`	CRAL_TRIO_2	310	388	0.00018	22.6
TkA01G122440	`PF25099`	GOLD_PATL1_C	407	491	3.3e-38	130.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56Z59`	Arabidopsis thaliana	sp\|Q56Z59\|PATL3_ARATH Patellin-3	69.700%	Swiss-Prot	High
`Q9M0R2`	Arabidopsis thaliana	sp\|Q9M0R2\|PATL5_ARATH Patellin-5	67.200%	Swiss-Prot	High
`Q56ZI2`	Arabidopsis thaliana	sp\|Q56ZI2\|PATL2_ARATH Patellin-2	55.300%	Swiss-Prot	Medium
`Q56WK6`	Arabidopsis thaliana	sp\|Q56WK6\|PATL1_ARATH Patellin-1	53.100%	Swiss-Prot	Medium
`Q9SCU1`	Arabidopsis thaliana	sp\|Q9SCU1\|PATL6_ARATH Patellin-6	46.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card