TkA01G118350 | RubberDandelionOmics

Gene overview

TkA01G118350

Reference: TK1151 Chr: Chr01 Coordinates: 30010350-30011020 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

483 bp · TkA01G118350|TK1151|cDNA

ATGGAGCAAAGCTATGGAGCATTGCCCGAGGAACTCTGGGACCTCCGTCTCCGTTTCACCATTGTCGATCAGATGTATTCCATTCACGGTATTGTCTCTCCCCTAATTCACCGATTTAGACACCTTAAAGCCCTAGATCTCAGTAAATTGAATCACAGTTATCTCGAAACGGCTCTTTACGAGTTCGCTCGTTCTTCCGTTGCCTTGAATTTGGAAATTCTCGATATCTCCAACCACGATTTGATACCACATCGAGGTTC...

CDS

Download CDS FASTA

483 bp · TkA01G118350|TK1151|CDS

ATGGAGCAAAGCTATGGAGCATTGCCCGAGGAACTCTGGGACCTCCGTCTCCGTTTCACCATTGTCGATCAGATGTATTCCATTCACGGTATTGTCTCTCCCCTAATTCACCGATTTAGACACCTTAAAGCCCTAGATCTCAGTAAATTGAATCACAGTTATCTCGAAACGGCTCTTTACGAGTTCGCTCGTTCTTCCGTTGCCTTGAATTTGGAAATTCTCGATATCTCCAACCACGATTTGATACCACATCGAGGTTC...

Protein

Download Protein FASTA

160 aa · TkA01G118350|TK1151|PROTEIN

MEQSYGALPEELWDLRLRFTIVDQMYSIHGIVSPLIHRFRHLKALDLSKLNHSYLETALYEFARSSVALNLEILDISNHDLIPHRGSKELGLSNRKIKVLRCANVIKGKVEDVELPEKADILISEPMGTLLINERMLESYVIARDRFLVPNGKMFPTVGR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G118350`
TK1151 ID	TkA01G118350
OH-1004 ID	LXL04_008572
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 99.375 / OH-1004 54.639 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G118350

Location Chr01:30010350-30011020 (-)

Description Similar to PRMT13: Probable histone-arginine methyltransferase 1.3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49020`	Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, and mRNA stability.	No verified direct reference in this release
`At3g06930`	Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, and mRNA stability (By similarity).	PARAQUAT TOLERANCE3 Is an E3 Ligase That Switches off Activated Oxidative Response by Targeting Histone-Modifying PROTEIN METHYLTRANSFERASE4b.2016 · DOI: 10.1371/journal.pgen.1006332

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YPT7`	Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, and mRNA stability.	No verified direct reference in this release
`Os07g0671700`	Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, and mRNA stability.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008572 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0019919 peptidyl-arginine methylation, to asymmetrical-dimethyl arginine Biological Process

GO:0032259 methylation Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:1902884 positive regulation of response to oxidative stress Biological Process

KEGG gene cross-reference

ath:AT3G06930

ath:AT5G49020

dosa:Os07g0671700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.455

Rank 1 · TkA01G118350 · TK1151

Nucleus0.365

Rank 2 · TkA01G118350 · TK1151

Mitochondrion0.114

Rank 3 · TkA01G118350 · TK1151

Endoplasmic reticulum0.082

Rank 4 · TkA01G118350 · TK1151

Cell membrane0.076

Rank 5 · TkA01G118350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25013LRR_Zer-134-85 aa

PF05185PRMT5103-139 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G118350	`PF25013`	LRR_Zer-1	34	85	0.15	13.0
TkA01G118350	`PF05185`	PRMT5	103	139	0.058	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A3KPF2`	Arabidopsis thaliana	sp\|A3KPF2\|ANM14_ARATH Probable histone-arginine methyltransferase 1.4	89.300%	Swiss-Prot	Low
`Q84W92`	Arabidopsis thaliana	sp\|Q84W92\|ANM13_ARATH Probable histone-arginine methyltransferase 1.3	91.100%	Swiss-Prot	Low
`A2YPT7`	Oryza sativa subsp. indica	sp\|A2YPT7\|CARM1_ORYSI Probable histone-arginine methyltransferase CARM1	92.900%	Swiss-Prot	Low
`Q7XI75`	Oryza sativa subsp. japonica	sp\|Q7XI75\|CARM1_ORYSJ Probable histone-arginine methyltransferase CARM1	92.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card