RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G110860
Reference: TK1151 Chr: Chr01 Coordinates: 28162792-28163369 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

501 bp · TkA01G110860|TK1151|cDNA

ATGACTTTGACAGTACTATGGAAGCCGCAGCCACCACCACCCATGAAGAATCAAAAGAAATCGCTGAAAGTAGCCGGAAATTCGAGTGCCATTACTGTTGCAGAAACTTCCCCACCTCACAAGCCTTGGGTGGCCATCAAAACGCACATAAACGAGAACGACAACACGCCAAAAGAGCTCACCTCCAGTCAAAACTACCACCGCTACGCCACCACTGCCGCAACTCCATCACCACCCTACTACCACCAGGCAACTCCGCC...

CDS

Download CDS FASTA

501 bp · TkA01G110860|TK1151|CDS

ATGACTTTGACAGTACTATGGAAGCCGCAGCCACCACCACCCATGAAGAATCAAAAGAAATCGCTGAAAGTAGCCGGAAATTCGAGTGCCATTACTGTTGCAGAAACTTCCCCACCTCACAAGCCTTGGGTGGCCATCAAAACGCACATAAACGAGAACGACAACACGCCAAAAGAGCTCACCTCCAGTCAAAACTACCACCGCTACGCCACCACTGCCGCAACTCCATCACCACCCTACTACCACCAGGCAACTCCGCC...

Protein

Download Protein FASTA

166 aa · TkA01G110860|TK1151|PROTEIN

MTLTVLWKPQPPPPMKNQKKSLKVAGNSSAITVAETSPPHKPWVAIKTHINENDNTPKELTSSQNYHRYATTAATPSPPYYHQATPPSTINNYNHRYYGGNSSYTSHQTPINGSPLALWRYPNPQNSTFNHDHAINTSSLISSNDGLRAYDSKPSVQDQVSLDLHL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G110860
TK1151 IDTkA01G110860
OH-1004 IDLXL04_004790
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)85.700
Protein coverage (%)TK1151 61.446 / OH-1004 46.281
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G110860
LocationChr01:28162792-28163369 (-)
DescriptionSimilar to ZFP8: Zinc finger protein 8
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_004790 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009735 response to cytokinin Biological Process
GO:0009736 cytokinin-activated signaling pathway Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009739 response to gibberellin Biological Process
GO:0009740 gibberellic acid mediated signaling pathway Biological Process
GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process
GO:0010026 trichome differentiation Biological Process
GO:0010090 trichome morphogenesis Biological Process
GO:0010091 trichome branching Biological Process
GO:0019760 glucosinolate metabolic process Biological Process
KEGG gene cross-reference
ath:AT1G67030
ath:AT1G68360
ath:AT2G41940
ath:AT3G58070
ath:AT5G06650
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.947
Rank 1 · TkA01G110860 · TK1151
Cytoplasm0.107
Rank 2 · TkA01G110860 · TK1151
Cell membrane0.040
Rank 3 · TkA01G110860 · TK1151
Endoplasmic reticulum0.037
Rank 4 · TkA01G110860 · TK1151
Plastid0.014
Rank 5 · TkA01G110860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser