TkA01G100350 | RubberDandelionOmics

Gene overview

TkA01G100350

Reference: TK1151 Chr: Chr01 Coordinates: 25374389-25376428 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1373 bp · TkA01G100350|TK1151|cDNA

CATGAGACCACACCCTTGCCTCCCAAGTCATTATTTCTCTATATATATCTACACCATATACATTTCTTAGAATCTTAACCAACGATGGCAAAACCAATAAGCCAAAGCTCAATTGAAGATATTTGCAAGCAAATTCACGGTTCTTTAGGAGATGTTAGCCTTTTGGTTCGAGTTTTTGCGGGTCAATTAACACAACAGGAATACCAAAAGACCCGAGAAAAGTACATGGAGATGTATGGTGAAGACTTATTTGATCATTT...

CDS

Download CDS FASTA

972 bp · TkA01G100350|TK1151|CDS

ATGGCAAAACCAATAAGCCAAAGCTCAATTGAAGATATTTGCAAGCAAATTCACGGTTCTTTAGGAGATGTTAGCCTTTTGGTTCGAGTTTTTGCGGGTCAATTAACACAACAGGAATACCAAAAGACCCGAGAAAAGTACATGGAGATGTATGGTGAAGACTTATTTGATCATTTACAAAACAAGATTGATAGTGAGACATCAAAAACGCGCACAATCCTGTCATTGTTGATGATTAATCCACATGAACGCGATGCAAT...

Protein

Download Protein FASTA

323 aa · TkA01G100350|TK1151|PROTEIN

MAKPISQSSIEDICKQIHGSLGDVSLLVRVFAGQLTQQEYQKTREKYMEMYGEDLFDHLQNKIDSETSKTRTILSLLMINPHERDAIVAKNAIFKERNCVNYKALIEIYVGRKSSHFFLIQQAYLSKFRRHLDQDIMSIEPPHSYRKILMALSASQKAHCVDISLHIGKCDAQRLFQTGEATSGGFKIDEGVVLEILSKRSIPQLNLAFSIYKHIYGHSYTKHFKNKYDGEFENALKFVVKFLTNPPKYYAKVLEASING...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G100350`
TK1151 ID	TkA01G100350
OH-1004 ID	LXL04_004878
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G100350`
Location	Chr01:25374389-25376428 (-)
Description	Similar to ANXA3: Annexin A3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004878` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006909 phagocytosis Biological Process GO:0006979 response to oxidative stress Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0009414 response to water deprivation Biological Process GO:0009651 response to salt stress Biological Process GO:0009835 fruit ripening Biological Process GO:0010595 positive regulation of endothelial cell migration Biological Process GO:0017156 calcium-ion regulated exocytosis Biological Process GO:0032940 secretion by cell Biological Process GO:0042742 defense response to bacterium Biological Process GO:0051054 positive regulation of DNA metabolic process Biological Process
KEGG gene cross-reference	ath:AT5G12380 hsa:306 mmu:11745 rno:25291 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.474

Rank 1 · TkA01G100350 · TK1151

Cell membrane0.255

Rank 2 · TkA01G100350 · TK1151

Nucleus0.250

Rank 3 · TkA01G100350 · TK1151

Mitochondrion0.061

Rank 4 · TkA01G100350 · TK1151

Extracellular0.060

Rank 5 · TkA01G100350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02824TGS8-30 aa

PF03489SapB_211-18 aa

PF00191Annexin34-64 aa

PF24360DUF751635-57 aa

PF05979DUF89637-61 aa

PF02173pKID38-45 aa

PF03489SapB_246-66 aa

PF03398Ist158-122 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G100350	`PF02824`	TGS	8	30	0.15	12.8
TkA01G100350	`PF03489`	SapB_2	11	18	0.38	11.7
TkA01G100350	`PF00191`	Annexin	34	64	6.3e-31	107.0
TkA01G100350	`PF24360`	DUF7516	35	57	0.0017	19.1
TkA01G100350	`PF05979`	DUF896	37	61	4.6	8.0
TkA01G100350	`PF02173`	pKID	38	45	0.039	14.2
TkA01G100350	`PF03489`	SapB_2	46	66	0.38	11.7
TkA01G100350	`PF03398`	Ist1	58	122	0.0068	17.1
TkA01G100350	`PF02173`	pKID	63	75	0.039	14.2
TkA01G100350	`PF00191`	Annexin	101	138	6.3e-31	107.0
TkA01G100350	`PF24360`	DUF7516	117	135	0.0017	19.1
TkA01G100350	`PF05979`	DUF896	121	139	4.6	8.0
TkA01G100350	`PF02173`	pKID	144	159	0.039	14.2
TkA01G100350	`PF24360`	DUF7516	172	182	0.0017	19.1
TkA01G100350	`PF00191`	Annexin	184	236	6.3e-31	107.0
TkA01G100350	`PF05979`	DUF896	219	232	4.6	8.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card