TkA01G091950 | RubberDandelionOmics

Gene overview

TkA01G091950

Reference: TK1151 Chr: Chr01 Coordinates: 23270145-23272468 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1502 bp · TkA01G091950|TK1151|cDNA

GCAGGAAGCACGTGTGTGCAGCTTTTCTTTTCTTTCTTTGACTCTTCACCACCCCTCATTTGGCCTTGGTACATCCATGTGTTGATGGGTACGGATTCCTAAATGTTCTTGAATGTCTTCAAATCTACAAACTGCATTCACCCACTGCCTTCAAATTCCTTGAACGAGTTCAATTTCGTCATATATTTCTTAAACCCTAGTTCTTCAGTCTCGATTAAGACCACACAATGTGGCAAGTATTGTTGGCTGCAGCAATAGCA...

CDS

Download CDS FASTA

1110 bp · TkA01G091950|TK1151|CDS

ATGTGGCAAGTATTGTTGGCTGCAGCAATAGCAGGATCTGGGTATTACGCTAAACAACTTCTCAACAAATCCGACGACAAAACTATCAATTATTCCCCCGAAAACGTTGATTCACCCATCGAGAATGCCGACGCAGACACATCAATTTTGGACGAAGACACATCATCGATTTTTAGGTTTTCTAGTACTTCATACGGATCAAAAAACCCTCGGAGGAAATTAGGTCGCGGTGGTGGGATTAAAGGTACTAGAAAAACAGT...

Protein

Download Protein FASTA

369 aa · TkA01G091950|TK1151|PROTEIN

MWQVLLAAAIAGSGYYAKQLLNKSDDKTINYSPENVDSPIENADADTSILDEDTSSIFRFSSTSYGSKNPRRKLGRGGGIKGTRKTVFEKKIGEGLVDDQRKSGKKFTVCLKKRRIGRNASAKCDSIDVKDKSSFGWGVGVGIMYMMSAGKAEINKLNTAVDETAKVVQELKAEISKRKSSRDSKVESTSNQNWVDIKSNQSAIEYPSIETTHIASSNFPATDECGDACSMITDEPHQEVAEMDQLEAELESELLKLHVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G091950`
TK1151 ID	TkA01G091950
OH-1004 ID	LXL04_004954
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G091950`
Location	Chr01:23270145-23272468 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004954` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.464

Rank 1 · TkA01G091950 · TK1151

Nucleus0.264

Rank 2 · TkA01G091950 · TK1151

Cytoplasm0.156

Rank 3 · TkA01G091950 · TK1151

Endoplasmic reticulum0.109

Rank 4 · TkA01G091950 · TK1151

Cell membrane0.105

Rank 5 · TkA01G091950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30915POLAR126-259 aa

PF04977DivIC146-183 aa

PF30854Par-4_C149-176 aa

PF11559ADIP151-204 aa

PF05739SNARE152-176 aa

PF08941USP8_interact157-179 aa

PF08614ATG16168-261 aa

PF04977DivIC239-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G091950	`PF30915`	POLAR	126	259	2.3e-17	63.6
TkA01G091950	`PF04977`	DivIC	146	183	0.0041	17.6
TkA01G091950	`PF30854`	Par-4_C	149	176	2.3	9.1
TkA01G091950	`PF11559`	ADIP	151	204	5.8	7.7
TkA01G091950	`PF05739`	SNARE	152	176	0.34	11.5
TkA01G091950	`PF08941`	USP8_interact	157	179	0.83	10.1
TkA01G091950	`PF08614`	ATG16	168	261	2.4	9.0
TkA01G091950	`PF04977`	DivIC	239	254	0.0041	17.6
TkA01G091950	`PF30854`	Par-4_C	243	251	2.3	9.1
TkA01G091950	`PF30915`	POLAR	261	325	2.3e-17	63.6
TkA01G091950	`PF04977`	DivIC	288	328	0.0041	17.6
TkA01G091950	`PF05739`	SNARE	288	320	0.34	11.5
TkA01G091950	`PF08941`	USP8_interact	288	330	0.83	10.1
TkA01G091950	`PF30854`	Par-4_C	288	322	2.3	9.1
TkA01G091950	`PF11559`	ADIP	289	329	5.8	7.7
TkA01G091950	`PF08614`	ATG16	290	329	2.4	9.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card