TkA01G090320 | RubberDandelionOmics

Gene overview

TkA01G090320

Reference: TK1151 Chr: Chr01 Coordinates: 22934185-22937156 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2215 bp · TkA01G090320|TK1151|cDNA

TTATTGGGTCCACAGTCACCTACCTGTACCGTTAATAAAACTCCGAGAACCCTCGATGTCCATTCGGTCTGTCGAAACCATCAGCGCTTTCCTGTCCCGCCTCCGCCTTCATCTCCACTGCCAGCATCACCCTATTCCGCCTCCGGAAACCTACACAGAGCTCAAAATGGAAGCCCTATGTTTCACTCCTTACGTCAAAATACCTAACAATGGCGTCATATTGCATAATGTCAACATAACCAGGAGAAGGAGGTATTCCG...

CDS

Download CDS FASTA

1917 bp · TkA01G090320|TK1151|CDS

ATGTCCATTCGGTCTGTCGAAACCATCAGCGCTTTCCTGTCCCGCCTCCGCCTTCATCTCCACTGCCAGCATCACCCTATTCCGCCTCCGGAAACCTACACAGAGCTCAAAATGGAAGCCCTATGTTTCACTCCTTACGTCAAAATACCTAACAATGGCGTCATATTGCATAATGTCAACATAACCAGGAGAAGGAGGTATTCCGTCTCCGCCACCATGTCCAAGTCAAAGGCGGAGGTCGAATTGCTATCTGCGACGGA...

Protein

Download Protein FASTA

638 aa · TkA01G090320|TK1151|PROTEIN

MSIRSVETISAFLSRLRLHLHCQHHPIPPPETYTELKMEALCFTPYVKIPNNGVILHNVNITRRRRYSVSATMSKSKAEVELLSATEASSINAVLRTREQHPPVLRVSSSSLQYESGKLGAVPDHKVEEGNGALSEMEYLTNILSSNRVYDVAIESPLSLAPKLSERLGVNIWLKREDLQPVFSFKLRGAYNMMAKLPKEQLSQGVICSSAGNHAQGVALAAKTLGCDAVIVMPVTTPQIKWESVKRLGATVVLEGDSYD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G090320`
TK1151 ID	TkA01G090320
OH-1004 ID	LXL04_005070
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G090320

Location Chr01:22934185-22937156 (-)

Description Similar to TD1: Threonine dehydratase 1 biosynthetic, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10050`	Catalyzes the formation of alpha-ketobutyrate from threonine in a two-step reaction.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005070 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002213 defense response to insect Biological Process

GO:0006565 L-serine catabolic process Biological Process

GO:0006566 L-threonine metabolic process Biological Process

GO:0006567 L-threonine catabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009097 isoleucine biosynthetic process Biological Process

GO:0009625 response to insect Biological Process

GO:0031349 positive regulation of defense response Biological Process

GO:0051289 protein homotetramerization Biological Process

GO:0080027 response to herbivore Biological Process

GO:0009507 chloroplast Cellular Component

GO:0003941 L-serine ammonia-lyase activity Molecular Function

KEGG gene cross-reference

ath:AT3G10050

bmj:BMULJ_02699

bmu:Bmul_0562

nau:109229701

sly:100037737

sly:543983

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.844

Rank 1 · TkA01G090320 · TK1151

Mitochondrion0.163

Rank 2 · TkA01G090320 · TK1151

Cytoplasm0.070

Rank 3 · TkA01G090320 · TK1151

Peroxisome0.042

Rank 4 · TkA01G090320 · TK1151

Nucleus0.033

Rank 5 · TkA01G090320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00667FAD_binding_143-87 aa

PF00585Thr_dehydrat_C51-87 aa

PF01906YbjQ_163-97 aa

PF00291PALP155-440 aa

PF00107ADH_zinc_N218-270 aa

PF01906YbjQ_1221-254 aa

PF00107ADH_zinc_N396-424 aa

PF00585Thr_dehydrat_C454-544 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G090320	`PF00667`	FAD_binding_1	43	87	0.069	13.4
TkA01G090320	`PF00585`	Thr_dehydrat_C	51	87	2.4e-47	159.4
TkA01G090320	`PF01906`	YbjQ_1	63	97	0.21	12.9
TkA01G090320	`PF00291`	PALP	155	440	1.1e-81	275.1
TkA01G090320	`PF00107`	ADH_zinc_N	218	270	0.034	14.8
TkA01G090320	`PF01906`	YbjQ_1	221	254	0.21	12.9
TkA01G090320	`PF00107`	ADH_zinc_N	396	424	0.034	14.8
TkA01G090320	`PF00585`	Thr_dehydrat_C	454	544	2.4e-47	159.4
TkA01G090320	`PF22190`	TTHA0829-like_ACT	466	511	0.0068	17.1
TkA01G090320	`PF01906`	YbjQ_1	542	553	0.21	12.9
TkA01G090320	`PF00585`	Thr_dehydrat_C	550	636	2.4e-47	159.4
TkA01G090320	`PF22190`	TTHA0829-like_ACT	564	595	0.0068	17.1
TkA01G090320	`PF01906`	YbjQ_1	594	611	0.21	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZSS6`	Arabidopsis thaliana	sp\|Q9ZSS6\|THD1_ARATH Threonine dehydratase biosynthetic, chloroplastic	75.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card