TkA01G083710 | RubberDandelionOmics

Gene overview

TkA01G083710

Reference: TK1151 Chr: Chr01 Coordinates: 21362200-21366663 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1576 bp · TkA01G083710|TK1151|cDNA

CCCTAATTACATCCTCACTCTCCTAAGATTAAACTCACTTCTCTACAATAAAACAAGAGAAGAAACTAATACTGTATAATCAAATACATGAAGTGACACTTTATGGGTGTAACTCGGTGAATTAGTTTGATGAGATTTGTTTATGTGATCATAATACTTTGTCATATGATGAATTATTTTAAGAGCCAATGGTTTTTCTCTGGTTTTGGAGTTTTCCACGTCTACTCATTATACAAGATGTTCGACGACTTAATACTTCT...

CDS

Download CDS FASTA

1482 bp · TkA01G083710|TK1151|CDS

GGAGATTTAACAGTTGAAGAGAATTTACGGTTTAGTGCTCGATGTAGACTGTCGGCCGATTTGCCAAAAGCAGATAAAGTTTTGATAACCGAAAGAGTGATTGAGGCGTTAGGACTTCAGGGAGTGAGAGATTCGAAAGTTGGAACGGTTGAAAAACGTGGGATTTCGGGAGGTCAGAAGAAAAGAGTAAATGTTGGACTTGAAATGGTGATGGAACCTTCGCTTTTAATATTAGATGAACCTACATCCGGTTTAGACAG...

Protein

Download Protein FASTA

493 aa · TkA01G083710|TK1151|PROTEIN

GDLTVEENLRFSARCRLSADLPKADKVLITERVIEALGLQGVRDSKVGTVEKRGISGGQKKRVNVGLEMVMEPSLLILDEPTSGLDSASSSLLLRALRREAMEGVNISMVVHQPSYSLYKMFDDLILLAKGGITVYHGPVDKVEEYFEGLGITIPERVNTPDHLIDILEGIIKPGGNVTAQQLPVRWMLHNGYRVPPDMLHLCDQTSSPSPPSHEPNNKDQRDVEKYNYFRTPDLSGRVTPGVFSQYKYYLGRVAKQRMR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G083710`
TK1151 ID	TkA01G083710
OH-1004 ID	LXL04_005033
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 47.132 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G083710

Location Chr01:21362200-21366663 (-)

Description Similar to WBC30: Putative white-brown complex homolog protein 30

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37010`	Putative white-brown complex homolog protein 30.	No verified direct reference in this release
`At5g60740`	ABC transporter G family member 28.	No verified direct reference in this release
`At1g53390`	ABC transporter G family member 24.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B9G5Y5`	ABC transporter G family member 25.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005033 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006869 lipid transport Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0015846 polyamine transport Biological Process

GO:0015878 biotin transport Biological Process

GO:0032218 riboflavin transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0097744 renal urate salt excretion Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0016324 apical plasma membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

KEGG gene cross-reference

ath:AT1G53390

ath:AT2G37010

ath:AT5G60740

dosa:Os10g0442900

mcc:574307

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.363

Rank 1 · TkA01G083710 · TK1151

Endoplasmic reticulum0.246

Rank 2 · TkA01G083710 · TK1151

Cytoplasm0.202

Rank 3 · TkA01G083710 · TK1151

Lysosome / Vacuole0.198

Rank 4 · TkA01G083710 · TK1151

Golgi apparatus0.170

Rank 5 · TkA01G083710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00005ABC_tran3-83 aa

PF13304AAA_2171-100 aa

PF19055ABC2_membrane_7112-215 aa

PF19055ABC2_membrane_7219-492 aa

PF01061ABC2_membrane246-410 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G083710	`PF00005`	ABC_tran	3	83	3.7e-08	34.8
TkA01G083710	`PF13304`	AAA_21	71	100	0.15	12.7
TkA01G083710	`PF19055`	ABC2_membrane_7	112	215	6.1e-179	595.9
TkA01G083710	`PF19055`	ABC2_membrane_7	219	492	6.1e-179	595.9
TkA01G083710	`PF01061`	ABC2_membrane	246	410	1.9e-08	34.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJK6`	Arabidopsis thaliana	sp\|Q9SJK6\|WBC30_ARATH Putative white-brown complex homolog protein 30	63.800%	Swiss-Prot	High
`Q9FF46`	Arabidopsis thaliana	sp\|Q9FF46\|AB28G_ARATH ABC transporter G family member 28	62.600%	Swiss-Prot	High
`Q9MAG3`	Arabidopsis thaliana	sp\|Q9MAG3\|AB24G_ARATH ABC transporter G family member 24	61.000%	Swiss-Prot	High
`B9G5Y5`	Oryza sativa subsp. japonica	sp\|B9G5Y5\|AB25G_ORYSJ ABC transporter G family member 25	55.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card