Gene Card
Gene overview
cDNA / CDS / Protein Sequences
930 bp · TkA01G079790|TK1151|cDNA
ATGGTCAAACAATCTCTCTTAGTTCATCGGCTTTATTCCAACAAACCTTCTCCGATGAAGAGAAATGCCAGCAATTTACGGGTCGTTTTCAGTTTTGGGATCAAAGGTACGTTCTTGGAGTACGTTGACCTTTCAAACAATCAAATTTCAGGGAACATTCCTAGTACGATTTCGAATCTTGGGAATCTTGCAAGGTTTGATGTTCCGAGGAATCGGATTACGGGAACAATTCCTCCAAGTTTGGGGAAATTGTCGAAATT...
930 bp · TkA01G079790|TK1151|CDS
ATGGTCAAACAATCTCTCTTAGTTCATCGGCTTTATTCCAACAAACCTTCTCCGATGAAGAGAAATGCCAGCAATTTACGGGTCGTTTTCAGTTTTGGGATCAAAGGTACGTTCTTGGAGTACGTTGACCTTTCAAACAATCAAATTTCAGGGAACATTCCTAGTACGATTTCGAATCTTGGGAATCTTGCAAGGTTTGATGTTCCGAGGAATCGGATTACGGGAACAATTCCTCCAAGTTTGGGGAAATTGTCGAAATT...
Protein
Download Protein FASTA309 aa · TkA01G079790|TK1151|PROTEIN
MVKQSLLVHRLYSNKPSPMKRNASNLRVVFSFGIKGTFLEYVDLSNNQISGNIPSTISNLGNLARFDVPRNRITGTIPPSLGKLSKLGWLDISSNSIGGKIPTSLLVIKYLRHVNIKGNKLCGEIPQGRPLNVFPKAAYVQNQTSTPTSSMEILHLSNPFLCNFKYISPELVLVQYGELSRDGEQVITVGDSITEEIIKPSCEHTIELPATEACTLIWEARVVGCEVSYGLNLFRVQKMGTRLLFRNRASLQRAATDLCS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G079790 |
|---|---|
| TK1151 ID | TkA01G079790 |
| OH-1004 ID | LXL04_002931 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 89.700 |
| Protein coverage (%) | TK1151 72.492 / OH-1004 75.421Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G079790 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:20418233-20419162 (-) | |||||||||
| Description | Similar to PATL1: Patellin-1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006952 defense response Biological Process GO:0009860 pollen tube growth Biological Process GO:0051301 cell division Biological Process GO:0071365 cellular response to auxin stimulus Biological Process GO:1901703 protein localization involved in auxin polar transport Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005773 vacuole Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009506 plasmodesma Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G22530 ath:AT1G72150 ath:AT1G72160 ath:AT4G09160 dosa:Os01g0809300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13516LRR_637-51 aaPF00560LRR_139-60 aaPF13855LRR_839-73 aaPF12799LRR_439-73 aaPF23598LRR_1439-112 aaPF00560LRR_162-84 aaPF13855LRR_862-121 aaPF12799LRR_463-95 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G079790 | PF13516 | LRR_6 | 37 | 51 | 0.0085 | 16.8 |
| TkA01G079790 | PF00560 | LRR_1 | 39 | 60 | 1.3e-13 | 48.9 |
| TkA01G079790 | PF13855 | LRR_8 | 39 | 73 | 8.3e-07 | 29.4 |
| TkA01G079790 | PF12799 | LRR_4 | 39 | 73 | 0.0001 | 23.1 |
| TkA01G079790 | PF23598 | LRR_14 | 39 | 112 | 0.00026 | 20.6 |
| TkA01G079790 | PF00560 | LRR_1 | 62 | 84 | 1.3e-13 | 48.9 |
| TkA01G079790 | PF13855 | LRR_8 | 62 | 121 | 8.3e-07 | 29.4 |
| TkA01G079790 | PF12799 | LRR_4 | 63 | 95 | 0.0001 | 23.1 |
| TkA01G079790 | PF00560 | LRR_1 | 87 | 105 | 1.3e-13 | 48.9 |
| TkA01G079790 | PF12799 | LRR_4 | 90 | 121 | 0.0001 | 23.1 |
| TkA01G079790 | PF13516 | LRR_6 | 90 | 100 | 0.0085 | 16.8 |
| TkA01G079790 | PF13516 | LRR_6 | 110 | 121 | 0.0085 | 16.8 |
| TkA01G079790 | PF00560 | LRR_1 | 111 | 127 | 1.3e-13 | 48.9 |
| TkA01G079790 | PF13855 | LRR_8 | 150 | 158 | 8.3e-07 | 29.4 |
| TkA01G079790 | PF12799 | LRR_4 | 150 | 161 | 0.0001 | 23.1 |
| TkA01G079790 | PF13516 | LRR_6 | 150 | 157 | 0.0085 | 16.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.