TkA01G077360 | RubberDandelionOmics

Gene overview

TkA01G077360

Reference: TK1151 Chr: Chr01 Coordinates: 19735018-19738005 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1941 bp · TkA01G077360|TK1151|cDNA

CACTCTCTCATTCAGACAAACCAGCCGCTCATGCAACCACCGCAAAGTCCACATCTATTAATGATTTAATTCCACTTCCAGAATAACAATTATGAGCAAACCTTCACGGGATTAAAGTGCCTGTGGATCACGATTCTTCTATGGATGAGGTCAACGGCGTAATGCCTCCGTATGCCGCCGGTGCCGGCGTAGGATTCGGAAGCAATGCTCAGAGAGTGTCGACGGAGGATTGGAGATTTCACGCGACGGAGTTCGCGAAG...

CDS

Download CDS FASTA

1536 bp · TkA01G077360|TK1151|CDS

ATGGATGAGGTCAACGGCGTAATGCCTCCGTATGCCGCCGGTGCCGGCGTAGGATTCGGAAGCAATGCTCAGAGAGTGTCGACGGAGGATTGGAGATTTCACGCGACGGAGTTCGCGAAGGGAGTGGCGGAATTGAGCGTTGAATTTGGGAAAGGATGTAGGGATGTGGTCAGGCAGAGTGTATTGAGGGATGATTCGTTCGTTGTGAGGAATTTCGGAGGTCCGTGTAAGTCCGCTTGTACGAAATTGAAGTTTTTAAA...

Protein

Download Protein FASTA

511 aa · TkA01G077360|TK1151|PROTEIN

MDEVNGVMPPYAAGAGVGFGSNAQRVSTEDWRFHATEFAKGVAELSVEFGKGCRDVVRQSVLRDDSFVVRNFGGPCKSACTKLKFLNEYLPEDRDPMHSWSVVSFVFAVVIAVLIVTSESDTTTPLIQKLHIYPPNATRILLPDGRHLAYHEQGVSSESARFTLIASHSFLSSRLAGIPGIKASLLQEFGVRLVTYDIPGFGESDPHPNRNLESSAMDMLYLSYAVHITDKFWVVGHSSGCIHTWAALKYIPDRIAGAFM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G077360`
TK1151 ID	TkA01G077360
OH-1004 ID	LXL04_005190
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 97.610 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G077360`
Location	Chr01:19735018-19738005 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005190` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.469

Rank 1 · TkA01G077360 · TK1151

Golgi apparatus0.188

Rank 2 · TkA01G077360 · TK1151

Cytoplasm0.148

Rank 3 · TkA01G077360 · TK1151

Nucleus0.132

Rank 4 · TkA01G077360 · TK1151

Mitochondrion0.111

Rank 5 · TkA01G077360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12697Abhydrolase_6101-153 aa

PF08386Abhydrolase_4111-129 aa

PF00561Abhydrolase_1112-152 aa

PF12697Abhydrolase_6183-448 aa

PF00561Abhydrolase_1185-450 aa

PF12146Hydrolase_4185-278 aa

PF06821Ser_hydrolase228-274 aa

PF12146Hydrolase_4410-445 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G077360	`PF12697`	Abhydrolase_6	101	153	3.6e-10	41.5
TkA01G077360	`PF08386`	Abhydrolase_4	111	129	0.2	12.5
TkA01G077360	`PF00561`	Abhydrolase_1	112	152	5.9e-18	66.1
TkA01G077360	`PF12697`	Abhydrolase_6	183	448	3.6e-10	41.5
TkA01G077360	`PF00561`	Abhydrolase_1	185	450	5.9e-18	66.1
TkA01G077360	`PF12146`	Hydrolase_4	185	278	8.1e-07	29.3
TkA01G077360	`PF06821`	Ser_hydrolase	228	274	0.00039	21.1
TkA01G077360	`PF12146`	Hydrolase_4	410	445	8.1e-07	29.3
TkA01G077360	`PF08386`	Abhydrolase_4	414	470	0.2	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card