TkA01G069260 | RubberDandelionOmics

Gene overview

TkA01G069260

Reference: TK1151 Chr: Chr01 Coordinates: 17739022-17740800 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1045 bp · TkA01G069260|TK1151|cDNA

TCAGCTTCAACTACAGCTGCCCGAATCTCCTCGAACTTCGAGGCCTTTTTGCATGTATATATATATTCACCCTCCGCCACCTCCCTCCACCACCGTATTCACGAATCCCTCAAAAGAAACTTCACTTCCTCCATCACAACAAGCAAGATGAGTAGGCCAGGAGATTGGAACTGCAGGTCATGCCAGCACTTGAACTTCCAGAGGAGGGACTCGTGCCAGAGATGTGGGGAGGCGAGGCTTGGTGGTGGTGGCGGTGGCGG...

CDS

Download CDS FASTA

663 bp · TkA01G069260|TK1151|CDS

TCAGCTTCAACTACAGCTGCCCGAATCTCCTCGAACTTCGAGGCCTTTTTGCATGTATATATATATTCACCCTCCGCCACCTCCCTCCACCACCGTATTCACGAATCCCTCAAAAGAAACTTCACTTCCTCCATCACAACAAGCAAGATGAGTAGGCCAGGAGATTGGAACTGCAGGTCATGCCAGCACTTGAACTTCCAGAGGAGGGACTCGTGCCAGAGATGTGGGGAGGCGAGGCTTGGTGGTGGTGGCGGTGGCGG...

Protein

Download Protein FASTA

220 aa · TkA01G069260|TK1151|PROTEIN

SASTTAARISSNFEAFLHVYIYSPSATSLHHRIHESLKRNFTSSITTSKMSRPGDWNCRSCQHLNFQRRDSCQRCGEARLGGGGGGGGGGFGVRGSVINVNPSVFGFTGPDVRPGDWYCNVGNCGAHNFASRSSCFKCGAFKDELAAGGGGGVFDGDMSRGRGFGFGGGSGGGGGSSRSGWKSGDWICGRPGCNEHNFASRMECFRCNAPRESGNNQSPY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G069260`
TK1151 ID	TkA01G069260
OH-1004 ID	LXL04_002658
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	40.400
Protein coverage (%)	TK1151 72.273 / OH-1004 97.710 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G069260`
Location	Chr01:17739022-17740800 (-)
Description	Similar to ZRANB2: Zinc finger Ran-binding domain-containing protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002658` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0031445 regulation of heterochromatin formation Biological Process GO:0071502 cellular response to temperature stimulus Biological Process GO:0005634 nucleus Cellular Component GO:0005694 chromosome Cellular Component GO:0005737 cytoplasm Cellular Component GO:0010494 cytoplasmic stress granule Cellular Component GO:0140453 protein aggregate center Cellular Component GO:0000175 3'-5'-RNA exonuclease activity Molecular Function GO:0003729 mRNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	afm:AFUA_5G02160 ani:ANIA_08055 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.514

Rank 1 · TkA01G069260 · TK1151

Cytoplasm0.353

Rank 2 · TkA01G069260 · TK1151

Plastid0.216

Rank 3 · TkA01G069260 · TK1151

Mitochondrion0.065

Rank 4 · TkA01G069260 · TK1151

Peroxisome0.046

Rank 5 · TkA01G069260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01155HypA51-80 aa

PF00641Zn_ribbon_RanBP52-76 aa

PF12172zf-ChsH258-79 aa

PF00641Zn_ribbon_RanBP113-140 aa

PF01155HypA114-148 aa

PF12172zf-ChsH2123-142 aa

PF00641Zn_ribbon_RanBP182-212 aa

PF12172zf-ChsH2191-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G069260	`PF01155`	HypA	51	80	4.8	8.0
TkA01G069260	`PF00641`	Zn_ribbon_RanBP	52	76	7.6e-18	64.2
TkA01G069260	`PF12172`	zf-ChsH2	58	79	1.1	9.8
TkA01G069260	`PF00641`	Zn_ribbon_RanBP	113	140	7.6e-18	64.2
TkA01G069260	`PF01155`	HypA	114	148	4.8	8.0
TkA01G069260	`PF12172`	zf-ChsH2	123	142	1.1	9.8
TkA01G069260	`PF00641`	Zn_ribbon_RanBP	182	212	7.6e-18	64.2
TkA01G069260	`PF12172`	zf-ChsH2	191	207	1.1	9.8
TkA01G069260	`PF01155`	HypA	200	210	4.8	8.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card