TkA01G066270 | RubberDandelionOmics

Gene overview

TkA01G066270

Reference: TK1151 Chr: Chr01 Coordinates: 16943027-16949043 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3534 bp · TkA01G066270|TK1151|cDNA

ATGCACAGCACAGGCAAGTTCCATGGCGGGTTCTCCGTACACCCTGCGAAACTTTCTCTTTCTCAATCTCTCCTCCATTACTCATGATTCCTCCCAATTCTTCGCTAAACGTTAGTCATTCATCTACAAACCGACAAAACGAATTCTCACATTTTCATAACGAATTCCTCATCAAACCTGAAACCTGAAACAAACAAGAAGCTTACCAAAACCTAACGCATCGCATTCATATAACATCGATCGATGAGTAATTGAGAATT...

CDS

Download CDS FASTA

2649 bp · TkA01G066270|TK1151|CDS

ATGTTTCTTATAGAACCAAAATATTTCAGTCTTCATGGTCTCATTCGCGGTGAAAACATGGAGCTAGGTCGCGATTCAGATACAGGTGGTCAGGTGAAATATGTAGTGGAACTAGCAAGGGCATTGGGGGCAATGCCAGGGATTTATCGAGTAGATTTGCTGACTAGACAAGTTTCAGCACCCGGCGTTGACTGGTCATACGGCGAACCGACGGAAATGCTGAACCCACTCAACGACGACGATATCGAAACCGGCGAGAG...

Protein

Download Protein FASTA

882 aa · TkA01G066270|TK1151|PROTEIN

MFLIEPKYFSLHGLIRGENMELGRDSDTGGQVKYVVELARALGAMPGIYRVDLLTRQVSAPGVDWSYGEPTEMLNPLNDDDIETGESSGAYIIRIPFGPNNKYIPKEHLWPHIPEFVDGALSYILQMSKVLADQIGDGKPVWPASIHGHYADAGNAAALLSGTLNVPMLFTGHSLGRDKLEQILKQGRQSKDDINTTYRIMRRIEAEEIAVDSSEVIITSTRQEIEEQWGLYDGFDPVMERKLRARNRRNVSCFGRFMPR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G066270`
TK1151 ID	TkA01G066270
OH-1004 ID	LXL04_028085
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	61.300
Protein coverage (%)	TK1151 98.866 / OH-1004 81.380 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G066270`
Location	Chr01:16943027-16949043 (+)
Description	Similar to SPS1: Probable sucrose-phosphate synthase 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028085` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005986 sucrose biosynthetic process Biological Process GO:0071836 nectar secretion Biological Process GO:0005634 nucleus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009506 plasmodesma Cellular Component GO:0046524 sucrose-phosphate synthase activity Molecular Function
KEGG gene cross-reference	ath:AT5G20280 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.529

Rank 1 · TkA01G066270 · TK1151

Nucleus0.284

Rank 2 · TkA01G066270 · TK1151

Mitochondrion0.120

Rank 3 · TkA01G066270 · TK1151

Plastid0.098

Rank 4 · TkA01G066270 · TK1151

Cell membrane0.073

Rank 5 · TkA01G066270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00862GT-B_Sucrose_synth9-268 aa

PF13439Glyco_transf_429-182 aa

PF13579Glyco_trans_4_429-223 aa

PF00534Glycos_transf_1297-471 aa

PF13692Glyco_trans_1_4302-459 aa

PF20706GT4-conflict390-469 aa

PF13439Glyco_transf_4405-427 aa

PF13439Glyco_transf_4451-489 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G066270	`PF00862`	GT-B_Sucrose_synth	9	268	2.5e-10	40.4
TkA01G066270	`PF13439`	Glyco_transf_4	29	182	0.0014	19.4
TkA01G066270	`PF13579`	Glyco_trans_4_4	29	223	0.0015	19.7
TkA01G066270	`PF00534`	Glycos_transf_1	297	471	8.6e-25	88.0
TkA01G066270	`PF13692`	Glyco_trans_1_4	302	459	1.2e-14	55.4
TkA01G066270	`PF20706`	GT4-conflict	390	469	0.0017	18.1
TkA01G066270	`PF13439`	Glyco_transf_4	405	427	0.0014	19.4
TkA01G066270	`PF13439`	Glyco_transf_4	451	489	0.0014	19.4
TkA01G066270	`PF05116`	S6PP	603	815	4.6e-15	56.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card