Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1461 bp · TkA01G048560|TK1151|cDNA
AAAAAACATGAAAACGGCATCGTTCCATTGGAAACTCTACAAGAACACCACAGATCTCTATATGTTCCCTCCTTATCTTTCAACCATATCAACGAGAATGGCAATTCTCACCACTCTATGGGCACCATTGTCTCCTTCCTGTATCTCTTCAAAATCACTCAAACACATTCATCTCACTTGCCCTAAAATCACAATCTCACTTTCGAATTCCAATTTTACATCCGTTTCAGTTCACTCCTTCAATCCAATCAATCTCGACC...
2730 bp · TkA01G048560|TK1151|CDS
ATGAAAACGGCATCGTTCCATTGGAAACTCTACAAGAACACCACAGATCTCTATATGTTCCCTCCTTATCTTTCAACCATATCAACGAGAATGGCAATTCTCACCACTCTATGGGCACCATTGTCTCCTTCCTGTATCTCTTCAAAATCACTCAAACACATTCATCTCACTTGCCCTAAAATCACAATCTCACTTTCGAATTCCAATTTTACATCCGTTTCAGTTCACTCCTTCAATCCAATCAATCTCGACCCCTCAAG...
Protein
Download Protein FASTA909 aa · TkA01G048560|TK1151|PROTEIN
MKTASFHWKLYKNTTDLYMFPPYLSTISTRMAILTTLWAPLSPSCISSKSLKHIHLTCPKITISLSNSNFTSVSVHSFNPINLDPSRKPVNFICSSSSSVSTPTTNYEFSDESNEVELRLFLGDKTIQSSKDVSVDIDEKFLTIKTKHNGSFTTAMEISLYEKIKPAETIWLLDDDQLVVNLKKQDPSVKWPDITETWESLTVGVTQLLKGTSVYLVGESSEINHKISRELAVGLGYTPLNTEELLETFTKTKLVIAEGS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G048560 |
|---|---|
| TK1151 ID | TkA01G048560 |
| OH-1004 ID | LXL04_005453 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 87.200 |
| Protein coverage (%) | TK1151 99.560 / OH-1004 49.260Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G048560 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:12533600-12542422 (-) | |||||||||
| Description | Similar to SKL2: Probable inactive shikimate kinase like 2, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000303 response to superoxide Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0002758 innate immune response-activating signaling pathway Biological Process GO:0006809 nitric oxide biosynthetic process Biological Process GO:0006950 response to stress Biological Process GO:0006970 response to osmotic stress Biological Process GO:0006979 response to oxidative stress Biological Process GO:0009073 aromatic amino acid family biosynthetic process Biological Process GO:0009414 response to water deprivation Biological Process GO:0009651 response to salt stress Biological Process GO:0009723 response to ethylene Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G32230 ath:AT1G33520 ath:AT2G35500 ath:AT2G35510 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04969CS106-184 aaPF12656G-patch_2223-240 aaPF12656G-patch_2609-666 aaPF01585G-patch623-664 aaPF18131KN17_SH3744-789 aaPF25088GPKOW_C750-857 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G048560 | PF04969 | CS | 106 | 184 | 2.9e-07 | 32.1 |
| TkA01G048560 | PF12656 | G-patch_2 | 223 | 240 | 9.9e-19 | 67.9 |
| TkA01G048560 | PF12656 | G-patch_2 | 609 | 666 | 9.9e-19 | 67.9 |
| TkA01G048560 | PF01585 | G-patch | 623 | 664 | 2.8e-05 | 24.7 |
| TkA01G048560 | PF18131 | KN17_SH3 | 744 | 789 | 0.0019 | 18.9 |
| TkA01G048560 | PF25088 | GPKOW_C | 750 | 857 | 3.2e-38 | 130.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.