TkA01G045650 | RubberDandelionOmics

Gene overview

TkA01G045650

Reference: TK1151 Chr: Chr01 Coordinates: 11805422-11810812 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2297 bp · TkA01G045650|TK1151|cDNA

GAAATGACACGCATCCATTTTAACAACGCAAGAACCGCTAATGTTCCATCTCCTCCCCTAAATCGACAGACCTTCTGAAAACGCTTTTTAAATTCCTGCCAGACCATCCGTCGTTTTCTCATTTGTTCCTCTAATCTTCAATAACTTGTAGTGAGGGAGCAGTTCAATCTCCGTTTACCATGCTGCGGAGGTCTATATTGGAAATATCTTCTCGTCGATCAGTAGGGCCACGAATAACAACTCAGATACCTTTGTATCTT...

CDS

Download CDS FASTA

1842 bp · TkA01G045650|TK1151|CDS

ATGCTGCGGAGGTCTATATTGGAAATATCTTCTCGTCGATCAGTAGGGCCACGAATAACAACTCAGATACCTTTGTATCTTTCCTCTAGGAAGGAATATTCGGCTGCATCTGAATCAAATTCACCCAAGGGATCAGGTTCACCAAACTCCAGGGGCAATTTGTCCAAAGTTTTTATAGGAAGTATAGCCTTAGGTGCTGGTGGTATAGCTGCATACCAAACTGGCTACTTAGATAAAGCATTAAAGAAGGAACAAACTAT...

Protein

Download Protein FASTA

613 aa · TkA01G045650|TK1151|PROTEIN

MLRRSILEISSRRSVGPRITTQIPLYLSSRKEYSAASESNSPKGSGSPNSRGNLSKVFIGSIALGAGGIAAYQTGYLDKALKKEQTIDLNIHKEPQHSKTVSGDLQSGESVEQVAVQNVKDSEILSPPVDHGEKAVETDPYYGRREVENENQQEIKQLRVSESIDEKLPISTSDSHDSVEKFQDEVGTKSEDVKDTTQDHEEVQITSVPNEVAPVLKENDIKSEESQQELSSNMPQGIESNGNKEADSLLDEYLLKDKSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G045650`
TK1151 ID	TkA01G045650
OH-1004 ID	LXL04_015941
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G045650

Location Chr01:11805422-11810812 (+)

Description Similar to mic60: MICOS complex subunit mic60 (Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39690`	Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane (By similarity).	AtMic60 Is Involved in Plant Mitochondria Lipid Trafficking and Is Part of a Large Complex.2016 · DOI: 10.1016/j.cub.2016.01.011

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015941 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006869 lipid transport Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0032368 regulation of lipid transport Biological Process

GO:0042407 cristae formation Biological Process

GO:0097035 regulation of membrane lipid distribution Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0061617 MICOS complex Cellular Component

GO:0098800 inner mitochondrial membrane protein complex Cellular Component

GO:1901612 cardiolipin binding Molecular Function

KEGG gene cross-reference

ath:AT4G39690

cal:CAALFM_CR03530WA

ctp:CTRG_00745

ncr:NCU00894

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.605

Rank 1 · TkA01G045650 · TK1151

Plastid0.122

Rank 2 · TkA01G045650 · TK1151

Cytoplasm0.118

Rank 3 · TkA01G045650 · TK1151

Peroxisome0.102

Rank 4 · TkA01G045650 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA01G045650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09731Mitofilin85-608 aa

PF07033Orthopox_B11R145-181 aa

PF02563Poly_export274-313 aa

PF17044BPTA308-385 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G045650	`PF09731`	Mitofilin	85	608	1.8e-67	229.4
TkA01G045650	`PF07033`	Orthopox_B11R	145	181	0.11	13.0
TkA01G045650	`PF02563`	Poly_export	274	313	0.046	14.6
TkA01G045650	`PF17044`	BPTA	308	385	0.043	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASV5`	Arabidopsis thaliana	sp\|Q9ASV5\|MIC60_ARATH MICOS complex subunit MIC60, mitochondrial	45.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card