TkA01G040850 | RubberDandelionOmics

Gene overview

TkA01G040850

Reference: TK1151 Chr: Chr01 Coordinates: 10515226-10517227 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1409 bp · TkA01G040850|TK1151|cDNA

GTAAACTTGGGTAAGTGTGTTTTGTGGGTTTTCTACATTATAATCTTCTTCAGATATAATAGCATTTATAAGATTCTCAAGTATTCCTTTCTGCCGGTACTGGTGGTTGGTGGTGATCAGATTGACGATGGGAAGACAGCCCTGCTGTGATAAACTAGGGGTGAAGAAAGGGCCGTGGACGGCGGAGGAAGATAATAAACTGGTCAACTTTATCTTAACCAGCGGCCAATGTTGTTGGCGAGCTGTTCCTAAGCTGGCTG...

CDS

Download CDS FASTA

840 bp · TkA01G040850|TK1151|CDS

ATGGGAAGACAGCCCTGCTGTGATAAACTAGGGGTGAAGAAAGGGCCGTGGACGGCGGAGGAAGATAATAAACTGGTCAACTTTATCTTAACCAGCGGCCAATGTTGTTGGCGAGCTGTTCCTAAGCTGGCTGGCCTCCGCCGGTGTGGGAAGAGCTGTCGTCTCCGGTGGACTAACTACCTTCGACCAGACTTGAAGCGGGGCCTACTCACTGAGTCTGAAGAACAACTCGTTATTGATCTCCATGCACGTCTCGGGAA...

Protein

Download Protein FASTA

279 aa · TkA01G040850|TK1151|PROTEIN

MGRQPCCDKLGVKKGPWTAEEDNKLVNFILTSGQCCWRAVPKLAGLRRCGKSCRLRWTNYLRPDLKRGLLTESEEQLVIDLHARLGNRWSKIAARLPGRTDNEIKNHWNTHIKKKLIKRGIDPVTHEPLEKESPDTKTSSSPGEHSSESENNSHLPPLESVNTTGNSEENSSSSPPENCSNISDDQSHKLFDNICEDEKLLSYLLGDDELPLVDTSTWELPNNAQNFNNDIGGFNSWDDCATWLFDCQDFGVHDFGLDCF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G040850`
TK1151 ID	TkA01G040850
OH-1004 ID	LXL04_005506
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G040850

Location Chr01:10515226-10517227 (-)

Description Similar to ODO1: Protein ODORANT1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66230`	Transcription factor that acts as a positive regulator of abscisic acid (ABA) signaling in response to salt stress.	An Arabidopsis R2R3-MYB transcription factor, AtMYB20, negatively regulates type 2C serine/threonine protein phosphatases to enhance salt tolerance.2013 · DOI: 10.1016/j.febslet.2013.04.028
`At4g28110`	Transcription factor involved in salt stress response.	AtMyb41 regulates transcriptional and metabolic responses to osmotic stress in Arabidopsis.2009 · DOI: 10.1104/pp.108.134874 Phosphorylation by AtMPK6 is required for the biological function of AtMYB41 in Arabidopsis.2012 · DOI: 10.1016/j.bbrc.2012.04.137 AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types.2014 · DOI: 10.1111/tpj.12624
`At3g61250`	Transcription factor that may play a role in flower development by repressing ANT.	Characterization of Arabidopsis MYB transcription factor gene AtMYB17 and its possible regulation by LEAFY and AGL15.2009 · DOI: 10.1016/s1673-8527(08)60096-x LATE MERISTEM IDENTITY2 acts together with LEAFY to activate APETALA1.2011 · DOI: 10.1242/dev.063073

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005506 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009094 L-phenylalanine biosynthetic process Biological Process

GO:0009423 chorismate biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010597 green leaf volatile biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G66230

ath:AT3G61250

ath:AT4G28110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.913

Rank 1 · TkA01G040850 · TK1151

Cytoplasm0.227

Rank 2 · TkA01G040850 · TK1151

Mitochondrion0.030

Rank 3 · TkA01G040850 · TK1151

Cell membrane0.020

Rank 4 · TkA01G040850 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA01G040850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding14-61 aa

PF13921Myb_DNA-bind_617-76 aa

PF00249Myb_DNA-binding71-111 aa

PF13921Myb_DNA-bind_671-116 aa

PF00249Myb_DNA-binding196-203 aa

PF13921Myb_DNA-bind_6196-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G040850	`PF00249`	Myb_DNA-binding	14	61	1.8e-32	111.9
TkA01G040850	`PF13921`	Myb_DNA-bind_6	17	76	2e-16	60.6
TkA01G040850	`PF00249`	Myb_DNA-binding	71	111	1.8e-32	111.9
TkA01G040850	`PF13921`	Myb_DNA-bind_6	71	116	2e-16	60.6
TkA01G040850	`PF00249`	Myb_DNA-binding	196	203	1.8e-32	111.9
TkA01G040850	`PF13921`	Myb_DNA-bind_6	196	203	2e-16	60.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7U7`	Arabidopsis thaliana	sp\|Q9C7U7\|MYB20_ARATH Transcription factor MYB20	84.500%	Swiss-Prot	Low
`Q9M0J5`	Arabidopsis thaliana	sp\|Q9M0J5\|MYB41_ARATH Transcription factor MYB41	71.100%	Swiss-Prot	Low
`Q9M2D9`	Arabidopsis thaliana	sp\|Q9M2D9\|MYB17_ARATH Transcription factor MYB17	72.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card