TkA01G027880 | RubberDandelionOmics

Gene overview

TkA01G027880

Reference: TK1151 Chr: Chr01 Coordinates: 7138686-7150332 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1401 bp · TkA01G027880|TK1151|cDNA

AGATGGCTCCGCCTGCACGTCTCAACGTGAACCAGTTAGCCCAAGTTAGGGAACTCATTGCTGAAGAGTTCAACAATGCCTTTAACGAGGTCATACCCAATGTCACTGCAAACATCGTCGACCAAGTTCGTGCCCTGTTAGACGAACGTTTTGCTGCTGGGCCTCCTCCTGGGGGAATGGTCCCTATTCCCCCCGTTCGTGACTTGATGTACTACTATGAGAAGTTTGGCAAGTGTAGCCCGCCCCATTGGGACGGGGAA...

CDS

Download CDS FASTA

1155 bp · TkA01G027880|TK1151|CDS

ATGGCTCCGCCTGCACGTCTCAACGTGAACCAGTTAGCCCAAGTTAGGGAACTCATTGCTGAAGAGTTCAACAATGCCTTTAACGAGGTCATACCCAATGTCACTGCAAACATCGTCGACCAAGTTCGTGCCCTGTTAGACGAACGTTTTGCTGCTGGGCCTCCTCCTGGGGGAATGGTCCCTATTCCCCCCGTTCGTGACTTGATGTACTACTATGAGAAGTTTGGCAAGTGTAGCCCGCCCCATTGGGACGGGGAAGA...

Protein

Download Protein FASTA

384 aa · TkA01G027880|TK1151|PROTEIN

MAPPARLNVNQLAQVRELIAEEFNNAFNEVIPNVTANIVDQVRALLDERFAAGPPPGGMVPIPPVRDLMYYYEKFGKCSPPHWDGEDNPVAAKHWLSNIEGAFMTIGCPDQFKVLVAKNQLRKRGKTWWNTTTGQMDEEAVRAITWAHFVQWFEARYVPKVEQQRMMQEFMALQQTNEAVSDLNAKFMEMLSFCPAFAGDEAWLVSRYTSILRTDIREFVGMQDFATLADVMGAARKREIELQTQTKRKIESTSSKTSEG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G027880`
TK1151 ID	TkA01G027880
OH-1004 ID	LXL04_016247
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	75.900
Protein coverage (%)	TK1151 95.312 / OH-1004 16.230 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G027880`
Location	Chr01:7138686-7150332 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016247` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.697

Rank 1 · TkA01G027880 · TK1151

Nucleus0.438

Rank 2 · TkA01G027880 · TK1151

Endoplasmic reticulum0.065

Rank 3 · TkA01G027880 · TK1151

Mitochondrion0.060

Rank 4 · TkA01G027880 · TK1151

Cell membrane0.054

Rank 5 · TkA01G027880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08653DASH_Dam18-27 aa

PF03732PEG10_N-capsid79-158 aa

PF19259Ty3_capsid82-265 aa

PF08653DASH_Dam1165-187 aa

PF08653DASH_Dam1224-237 aa

PF12511DUF3716281-329 aa

PF27939DUF8363287-341 aa

PF14392zf-CCHC_4287-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G027880	`PF08653`	DASH_Dam1	8	27	3.7	8.2
TkA01G027880	`PF03732`	PEG10_N-capsid	79	158	2.4e-10	41.3
TkA01G027880	`PF19259`	Ty3_capsid	82	265	4.2e-13	49.9
TkA01G027880	`PF08653`	DASH_Dam1	165	187	3.7	8.2
TkA01G027880	`PF08653`	DASH_Dam1	224	237	3.7	8.2
TkA01G027880	`PF12511`	DUF3716	281	329	0.12	13.0
TkA01G027880	`PF27939`	DUF8363	287	341	0.1	13.1
TkA01G027880	`PF14392`	zf-CCHC_4	287	303	0.29	11.5
TkA01G027880	`PF00098`	zf-CCHC	288	303	5e-07	30.2
TkA01G027880	`PF00098`	zf-CCHC	319	335	5e-07	30.2
TkA01G027880	`PF14392`	zf-CCHC_4	319	335	0.29	11.5
TkA01G027880	`PF03732`	PEG10_N-capsid	363	384	2.4e-10	41.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card