TkA01G018380 | RubberDandelionOmics

Gene overview

TkA01G018380

Reference: TK1151 Chr: Chr01 Coordinates: 4679247-4683979 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1697 bp · TkA01G018380|TK1151|cDNA

CGGATTCCTCGTCTTCCCGCCAAAATCCCTTCGCTAAGCATATGTTCTTCACCCTTTCCCGCCATTTCATCTTCCCCAAAATCCATCTTCACGACCTCCACAGCCTTCGGTACATCTGATTTCAAGCACATTTTCAGGGTTTGTGGGAAGTCGTCACTTCGTTCAAGTATGACTAAGGAAGCTCAGAATGAAAGAGATGACATGTTAATCGACGACCCCGAGCCCCAAAACGAGCAAATTGATGCTATTCCTGACGAATT...

CDS

Download CDS FASTA

1530 bp · TkA01G018380|TK1151|CDS

CGGATTCCTCGTCTTCCCGCCAAAATCCCTTCGCTAAGCATATGTTCTTCACCCTTTCCCGCCATTTCATCTTCCCCAAAATCCATCTTCACGACCTCCACAGCCTTCGGTACATCTGATTTCAAGCACATTTTCAGGGTTTGTGGGAAGTCGTCACTTCGTTCAAGTATGACTAAGGAAGCTCAGAATGAAAGAGATGACATGTTAATCGACGACCCCGAGCCCCAAAACGAGCAAATTGATGCTATTCCTGACGAATT...

Protein

Download Protein FASTA

509 aa · TkA01G018380|TK1151|PROTEIN

RIPRLPAKIPSLSICSSPFPAISSSPKSIFTTSTAFGTSDFKHIFRVCGKSSLRSSMTKEAQNERDDMLIDDPEPQNEQIDAIPDEFNPNYLKAYYGRLFPHADMFKWMSYGNDGKHPACDQSYFGRREFSFTLDNDIYLRFQSFKSASELENGIKDKCPFKIDIGPVYSVDPSKRLAYAQSGDNVFTPVERELVFDIDISDYDDARYCCSGADVCLDCWPLMTIAIKVLDTSLRDDFGFNHILWVYSGRRGVHCWVCDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G018380`
TK1151 ID	TkA01G018380
OH-1004 ID	LXL04_005759
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.800
Protein coverage (%)	TK1151 100.000 / OH-1004 96.970 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G018380`
Location	Chr01:4679247-4683979 (+)
Description	Similar to Prim1: DNA primase small subunit
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005759` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006261 DNA-templated DNA replication Biological Process GO:0006269 DNA replication, synthesis of primer Biological Process GO:0006270 DNA replication initiation Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005658 alpha DNA polymerase:primase complex Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016020 membrane Cellular Component GO:0000166 nucleotide binding Molecular Function GO:0000287 magnesium ion binding Molecular Function GO:0003899 DNA-directed RNA polymerase activity Molecular Function
KEGG gene cross-reference	dme:Dmel_CG7108 hsa:5557 mmu:19075 spo:2543323 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.530

Rank 1 · TkA01G018380 · TK1151

Mitochondrion0.232

Rank 2 · TkA01G018380 · TK1151

Nucleus0.146

Rank 3 · TkA01G018380 · TK1151

Cytoplasm0.095

Rank 4 · TkA01G018380 · TK1151

Peroxisome0.044

Rank 5 · TkA01G018380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01896DNA_primase_S196-429 aa

PF27287YomO273-342 aa

PF01364Peptidase_C25348-390 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G018380	`PF01896`	DNA_primase_S	196	429	5.7e-53	180.3
TkA01G018380	`PF27287`	YomO	273	342	0.025	15.0
TkA01G018380	`PF01364`	Peptidase_C25	348	390	0.21	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card