TkA01G013270 | RubberDandelionOmics

Gene overview

TkA01G013270

Reference: TK1151 Chr: Chr01 Coordinates: 3427218-3429575 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2277 bp · TkA01G013270|TK1151|cDNA

ATGGGTCGGATTTCGATTTTGATTTACACTATCTTCTATGTTTCAATAGCAAATTCTATTCAGCTTGATAATACCAAAACCTTCATAGTCAGGATTCAAAACGACTTGAAACCATCTGTTTTCACCGATGTAGAACATTGGTATAAGAACAAATTCAACACCATCGAAGATAACCAAGACTTTCTTCATGTCTACAAGACTGTTTTCCATGGCTTTTCAACAAGATTAAGTCCTCAAGAAGCTCAAGAACTGGAAACCCA...

CDS

Download CDS FASTA

2277 bp · TkA01G013270|TK1151|CDS

ATGGGTCGGATTTCGATTTTGATTTACACTATCTTCTATGTTTCAATAGCAAATTCTATTCAGCTTGATAATACCAAAACCTTCATAGTCAGGATTCAAAACGACTTGAAACCATCTGTTTTCACCGATGTAGAACATTGGTATAAGAACAAATTCAACACCATCGAAGATAACCAAGACTTTCTTCATGTCTACAAGACTGTTTTCCATGGCTTTTCAACAAGATTAAGTCCTCAAGAAGCTCAAGAACTGGAAACCCA...

Protein

Download Protein FASTA

758 aa · TkA01G013270|TK1151|PROTEIN

MGRISILIYTIFYVSIANSIQLDNTKTFIVRIQNDLKPSVFTDVEHWYKNKFNTIEDNQDFLHVYKTVFHGFSTRLSPQEAQELETHPSVMAVLPDETLKLHTTRSIQFLGLDSNEPNTLLKESDYGSNAIIGILDTGISPESSSFHDQDLGPIPSDWKGECMEGEHFTKNLCNKKIIGARYFTAGYDASIGETNGSTQIKSSRDTDGHGTHTASTAAGRVVSNASLFGYAQGVAVGVAPKARIAVYKICWGENCRESDI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G013270`
TK1151 ID	TkA01G013270
OH-1004 ID	LXL04_005843
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.400
Protein coverage (%)	TK1151 96.174 / OH-1004 24.926 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G013270

Location Chr01:3427218-3429575 (+)

Description Similar to SBT: Subtilisin-like protease

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14240`	Subtilisin-like protease SBT1.5.	No verified direct reference in this release
`At4g34980`	Subtilisin-like protease SBT1.6.	No verified direct reference in this release
`At5g67360`	Serine protease.	Ara12 subtilisin-like protease from Arabidopsis thaliana: purification, substrate specificity and tissue localization.2003 · DOI: 10.1042/bj20021125 A subtilisin-like serine protease essential for mucilage release from Arabidopsis seed coats.2008 · DOI: 10.1111/j.1365-313x.2008.03437.x
`At5g51750`	Subtilisin-like protease SBT1.3.	No verified direct reference in this release
`At3g14067`	Subtilisin-like protease SBT1.4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005843 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009609 response to symbiotic bacterium Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0005615 extracellular space Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004252 serine-type endopeptidase activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.596

Rank 1 · TkA01G013270 · TK1151

Lysosome / Vacuole0.116

Rank 2 · TkA01G013270 · TK1151

Cell membrane0.110

Rank 3 · TkA01G013270 · TK1151

Cytoplasm0.083

Rank 4 · TkA01G013270 · TK1151

Endoplasmic reticulum0.069

Rank 5 · TkA01G013270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05922Inhibitor_I927-102 aa

PF21864MORF_dom63-101 aa

PF00082Peptidase_S8127-573 aa

PF21864MORF_dom236-253 aa

PF02225PA381-447 aa

PF21864MORF_dom605-621 aa

PF17766fn3_6647-752 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G013270	`PF05922`	Inhibitor_I9	27	102	1.8e-14	54.9
TkA01G013270	`PF21864`	MORF_dom	63	101	0.0056	17.2
TkA01G013270	`PF00082`	Peptidase_S8	127	573	3.9e-48	164.9
TkA01G013270	`PF21864`	MORF_dom	236	253	0.0056	17.2
TkA01G013270	`PF02225`	PA	381	447	9.7e-10	39.2
TkA01G013270	`PF21864`	MORF_dom	605	621	0.0056	17.2
TkA01G013270	`PF17766`	fn3_6	647	752	1.5e-25	90.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LUM3`	Arabidopsis thaliana	sp\|Q9LUM3\|SBT15_ARATH Subtilisin-like protease SBT1.5	48.900%	Swiss-Prot	Medium
`O49607`	Arabidopsis thaliana	sp\|O49607\|SBT16_ARATH Subtilisin-like protease SBT1.6	50.700%	Swiss-Prot	High
`O65351`	Arabidopsis thaliana	sp\|O65351\|SBT17_ARATH Subtilisin-like protease SBT1.7	48.800%	Swiss-Prot	Medium
`Q9FLI4`	Arabidopsis thaliana	sp\|Q9FLI4\|SBT13_ARATH Subtilisin-like protease SBT1.3	44.400%	Swiss-Prot	Medium
`Q9LVJ1`	Arabidopsis thaliana	sp\|Q9LVJ1\|SBT14_ARATH Subtilisin-like protease SBT1.4	47.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card