TkA01G009300 | RubberDandelionOmics

Gene overview

TkA01G009300

Reference: TK1151 Chr: Chr01 Coordinates: 2523602-2526336 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1057 bp · TkA01G009300|TK1151|cDNA

TAAAAAAATTATTATAGATAGATGCACGTGCAACAATATCAAATGCAAATGATAATGATGATGATGATGGTGATGACGAGGAATACGAGGACGCTTCTTCTCCAAGTTTTCTTACTCCTACTGATCAAACTCATCCATTGGCCAATAGCCAGTTGGATCCGAACATGATCATGAACCAATTTATGCAAAATCCGGCTTTAATTGGTGTGTTAGACGGAATCCCGAATCAAACTGAGATGGAATCGCCAGATTTCTTAAGA...

CDS

Download CDS FASTA

663 bp · TkA01G009300|TK1151|CDS

ATGATCATGAACCAATTTATGCAAAATCCGGCTTTAATTGGTGTGTTAGACGGAATCCCGAATCAAACTGAGATGGAATCGCCAGATTTCTTAAGAAACATGATGGATCAAATAACTAGAAACCCCGAAATGATGACCGCAATCAATCAGCTCGGTCAACAGATGGTTGATAATCAAAATTTAGGTAGCATGTTTGCATCTATGACCGGGTCCCATAGCTACGACGGAGACGGTGGTCCCGATTGTGATGGCGGCGATCT...

Protein

Download Protein FASTA

220 aa · TkA01G009300|TK1151|PROTEIN

MIMNQFMQNPALIGVLDGIPNQTEMESPDFLRNMMDQITRNPEMMTAINQLGQQMVDNQNLGSMFASMTGSHSYDGDGGPDCDGGDLDMSFMVQQMMPFFSQSFHCEEDTSLNLLEHSLPPKPKVHRRCYSETASITGISVDCQMNLKEITKKIEDEYPALEIFSSVVETAALLHENIQDIYGLADLCADEELAQEFIEMMRRDVCRRLGKRYDRLESKS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G009300`
TK1151 ID	TkA01G009300
OH-1004 ID	LXL04_005891
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 63.037 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G009300`
Location	Chr01:2523602-2526336 (-)
Description	Similar to WLIN2A: LIM domain-containing protein WLIM2a
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005891` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0051017 actin filament bundle assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005856 cytoskeleton Cellular Component GO:0005886 plasma membrane Cellular Component GO:0003729 mRNA binding Molecular Function GO:0046872 metal ion binding Molecular Function GO:0051015 actin filament binding Molecular Function
KEGG gene cross-reference	ath:AT2G39900 ath:AT2G45800 ath:AT3G55770 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.494

Rank 1 · TkA01G009300 · TK1151

Nucleus0.413

Rank 2 · TkA01G009300 · TK1151

Mitochondrion0.112

Rank 3 · TkA01G009300 · TK1151

Cell membrane0.076

Rank 4 · TkA01G009300 · TK1151

Extracellular0.075

Rank 5 · TkA01G009300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08278DnaG_DnaB_bind7-57 aa

PF19011DUF574016-61 aa

PF09509Hypoth_Ymh32-63 aa

PF19011DUF5740121-155 aa

PF09509Hypoth_Ymh149-199 aa

PF19011DUF5740159-177 aa

PF08278DnaG_DnaB_bind188-220 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G009300	`PF08278`	DnaG_DnaB_bind	7	57	0.027	15.5
TkA01G009300	`PF19011`	DUF5740	16	61	0.11	13.1
TkA01G009300	`PF09509`	Hypoth_Ymh	32	63	0.18	12.3
TkA01G009300	`PF19011`	DUF5740	121	155	0.11	13.1
TkA01G009300	`PF09509`	Hypoth_Ymh	149	199	0.18	12.3
TkA01G009300	`PF19011`	DUF5740	159	177	0.11	13.1
TkA01G009300	`PF08278`	DnaG_DnaB_bind	188	220	0.027	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card